ID: 914990838

View in Genome Browser
Species Human (GRCh38)
Location 1:152498358-152498380
Sequence AATGGCCTTACTAAGTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914990838_914990843 5 Left 914990838 1:152498358-152498380 CCACCAGACTTAGTAAGGCCATT No data
Right 914990843 1:152498386-152498408 GGATGCAGTCCCATCAGAGGAGG No data
914990838_914990842 2 Left 914990838 1:152498358-152498380 CCACCAGACTTAGTAAGGCCATT No data
Right 914990842 1:152498383-152498405 TATGGATGCAGTCCCATCAGAGG No data
914990838_914990846 24 Left 914990838 1:152498358-152498380 CCACCAGACTTAGTAAGGCCATT No data
Right 914990846 1:152498405-152498427 GAGGCAGATTGAGCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914990838 Original CRISPR AATGGCCTTACTAAGTCTGG TGG (reversed) Intergenic
No off target data available for this crispr