ID: 914992493

View in Genome Browser
Species Human (GRCh38)
Location 1:152510977-152510999
Sequence TTCTGGAAGGGGAGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 894}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914992479_914992493 28 Left 914992479 1:152510926-152510948 CCATTCTTGAAGAAAGACAAGGA 0: 1
1: 0
2: 2
3: 26
4: 367
Right 914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG 0: 1
1: 0
2: 5
3: 90
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914992493 Original CRISPR TTCTGGAAGGGGAGGGTGGA AGG Exonic
900132446 1:1092811-1092833 CTCTGGAAGGTGGGGGTGGTCGG + Intronic
900191485 1:1354105-1354127 TCCTGGATGGCGAGGGTGGGAGG + Exonic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG + Intergenic
900874862 1:5334951-5334973 TTCTGAAAAGGGAGGCTAGATGG + Intergenic
900988291 1:6085970-6085992 TCCTGGGAGAGAAGGGTGGATGG - Intronic
901661822 1:10803303-10803325 TTCCGGAAGGTGTGGGTGAAGGG - Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902578307 1:17392422-17392444 TTCTGGAATGGGAAGGAGGCTGG - Intronic
902764970 1:18607991-18608013 TTCTGGAAGAGGAGGGAAGGTGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902833599 1:19033409-19033431 GGCTGGGTGGGGAGGGTGGACGG - Intergenic
902931763 1:19736439-19736461 ACCTGGGAGTGGAGGGTGGATGG - Intronic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903213987 1:21833137-21833159 TTCTGGAGAGGGAGGGCTGAGGG + Intronic
903224234 1:21885830-21885852 TTCTGGTAGAGAAGGGTGGGCGG - Intronic
903323728 1:22557284-22557306 TGCTGGAAGGGGAGGAGAGAGGG + Intergenic
903912893 1:26741242-26741264 TTCTGGAAGCCAAGGGAGGAGGG + Intronic
904386496 1:30145950-30145972 TGCTGCCAGGGGAGGGAGGATGG + Intergenic
904541184 1:31234446-31234468 TTCTGGAAGGTGGGGGCGGGGGG - Intronic
905452116 1:38063603-38063625 TTCTTGGAGGGGTGGGTGGGTGG + Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906020806 1:42627862-42627884 TTCTGCTAGGGCAGTGTGGAAGG + Intronic
906849040 1:49227943-49227965 TGCTGGAAGGGTAGGATGTAAGG - Intronic
907512568 1:54972742-54972764 TTCTGGGTTGGGTGGGTGGAGGG + Intergenic
907548651 1:55285436-55285458 TACTGGAAGGGGAAGGCAGAAGG + Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908114321 1:60925941-60925963 TTCTGGCAGGGAAGGGTGGAGGG - Intronic
908193606 1:61727711-61727733 TTTTGGAGGGAGAGGGAGGACGG - Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908492366 1:64658940-64658962 TTTTGGAGGGGTGGGGTGGATGG - Intronic
908597431 1:65703458-65703480 TACTAGAGGTGGAGGGTGGACGG - Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909011494 1:70340091-70340113 TTTTGGAAGGGCAAGGTGGGAGG - Intronic
909030423 1:70533162-70533184 TACCTTAAGGGGAGGGTGGATGG + Intergenic
909230227 1:73079804-73079826 TACTGGAGGTGGAGGGTGGGAGG - Intergenic
911193068 1:94966920-94966942 TTCTGCAGGGGGAGAGGGGAAGG + Intergenic
912276908 1:108268548-108268570 TTCTTGTAGGGGTGGGTGGGAGG + Intergenic
912291321 1:108425808-108425830 TTCTTGTAGGGGTGGGTGGGAGG - Intronic
912418678 1:109529071-109529093 TGCTGGAGGGTGAGGGTGCAGGG + Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912837645 1:113010469-113010491 CTCTGGAAGCGGAGGTTGCAAGG - Intergenic
912885082 1:113462548-113462570 TACTTGATGGGGAGGGTGAAAGG + Intronic
913211483 1:116586275-116586297 TTTTGGATGGGGAGGGAGAAAGG - Intronic
913379376 1:118191924-118191946 TTCTGGAGGGGTTGGGTGGTAGG + Intergenic
914258466 1:145979295-145979317 GTCTGGAAGAGGAGGGAGTATGG - Intergenic
914330217 1:146662193-146662215 TACTTGAGGTGGAGGGTGGAAGG - Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915373750 1:155373910-155373932 TTTTGGAAGGCCAGGGTGGGCGG - Intronic
916168356 1:161982677-161982699 TCCTGGAAGGGAAGGTGGGAGGG + Intergenic
916375806 1:164152149-164152171 TTCTGGAAGAAGAGTCTGGAAGG - Intergenic
916433902 1:164759210-164759232 TTTTTGCAGGTGAGGGTGGAAGG + Intronic
916466628 1:165079955-165079977 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
916517206 1:165530413-165530435 TTCTGGAAGGGGAAGCTGAGTGG + Intergenic
917284472 1:173410019-173410041 ATTTGGAAGGCCAGGGTGGATGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917715054 1:177726569-177726591 TTCAGAAGGTGGAGGGTGGAAGG + Intergenic
917984521 1:180302036-180302058 TATTGGGGGGGGAGGGTGGAGGG + Intronic
918420631 1:184361127-184361149 TTCTGAGAGTGGAAGGTGGAAGG - Intergenic
919204604 1:194405902-194405924 TTCAGGGAGTGGAGGGTGGGAGG + Intergenic
919536726 1:198796885-198796907 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
919654086 1:200180686-200180708 GGCTGGAAGGGGAGGCTGGGAGG - Intergenic
919902469 1:202054467-202054489 TCCTTGAGGGGGAGGCTGGAAGG + Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920078317 1:203353347-203353369 TCCTGGAAGTGGCGGGTGGGAGG - Intergenic
920169468 1:204061877-204061899 ATCTAGAAGGGGTGGTTGGAAGG + Intergenic
920210076 1:204321561-204321583 TATGGGAAGGGTAGGGTGGAAGG - Intronic
920618786 1:207523711-207523733 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920620568 1:207542282-207542304 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920622350 1:207560839-207560861 TCCTGGAAGCGGAGGGAGAAAGG + Exonic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921010018 1:211132784-211132806 TTCTGGAAGGGGTGGGGTGGGGG + Intronic
921044043 1:211460754-211460776 TTCTGGACGGGGCGGCTGGCCGG - Intergenic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922161384 1:223081245-223081267 TTCTAGAAGGGGAGGAATGAGGG + Intergenic
922351745 1:224739718-224739740 TCCTGGGAGCGGAGGCTGGAAGG + Exonic
922750746 1:228069013-228069035 TTCTGTAGGGGGATAGTGGAGGG + Intergenic
922911551 1:229221937-229221959 TTCTGGAAAGGAAGGGGAGAAGG + Intergenic
923401290 1:233617662-233617684 TTTTGGGAGGCCAGGGTGGAAGG + Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924387543 1:243513126-243513148 TTAGGGAAGGTGGGGGTGGAAGG + Intronic
924592096 1:245413797-245413819 GTCCTGAAGGGGAGAGTGGAGGG + Intronic
924710266 1:246525202-246525224 TTCAGAAAAGGGAGTGTGGATGG + Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1064863115 10:19848810-19848832 TTTTGGAAGGGGAGGATGGCAGG + Intronic
1065243659 10:23734958-23734980 TTATGGAAGGAAAGGGTGGCGGG - Intronic
1065812117 10:29451808-29451830 TTCAGGAAGGGAAGCATGGAGGG + Intergenic
1066471888 10:35706618-35706640 TACAGGAGGTGGAGGGTGGAAGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067345517 10:45435414-45435436 TCCAGGAAGGGGAGGGAGGGAGG - Intronic
1067524255 10:47028721-47028743 TGCTGGAAGGGGAGCCCGGAGGG + Intergenic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068668019 10:59696951-59696973 TTCTGGACGGGGCGGCTGGCCGG - Intronic
1068866927 10:61903894-61903916 AGCTGGCCGGGGAGGGTGGAGGG - Intronic
1068868490 10:61919176-61919198 TCATGAAAGGGCAGGGTGGAGGG - Intronic
1069175726 10:65286304-65286326 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1070007766 10:72441859-72441881 TTCTGGGAGGCCAGGGTGGGCGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070103496 10:73411291-73411313 CTCAGAAAGGGGAGGGTGAAAGG + Intronic
1070229994 10:74555500-74555522 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
1070602837 10:77877776-77877798 CCCTGGAAGGTGGGGGTGGAGGG + Intronic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG + Intronic
1072589774 10:96818771-96818793 TTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1073052032 10:100673560-100673582 TCTTGGAATGGGGGGGTGGAGGG - Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG + Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074425375 10:113346706-113346728 CTCTCCAAGGGAAGGGTGGAAGG - Intergenic
1074526518 10:114267797-114267819 TGCAGGAAGGTGAGGGAGGAGGG + Intronic
1075075153 10:119345706-119345728 TGCTGGCAGGGTGGGGTGGAGGG - Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1076214103 10:128679124-128679146 ATCTGGGAGGGGATTGTGGAGGG + Intergenic
1076354684 10:129843089-129843111 TTCTGGCATGGGGGGGAGGATGG + Intronic
1076404970 10:130205669-130205691 TTATGAAAGGAGCGGGTGGAAGG + Intergenic
1076470449 10:130714550-130714572 ATCTGGAAAGGCAGGGAGGATGG + Intergenic
1076707104 10:132308008-132308030 TTCTGGAAGGGGCGGGGGCGGGG + Intronic
1076747400 10:132521323-132521345 CCCTGAAAGGGGAGAGTGGAAGG + Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077790181 11:5430889-5430911 TTCTGGAGAGGGACGGTGGAAGG - Intronic
1077984322 11:7335462-7335484 TTCTGGGGGTGGAGGGTGGGAGG - Intronic
1078269515 11:9781939-9781961 TTTTGGGAGGTGAAGGTGGACGG + Intronic
1078896735 11:15603511-15603533 TTCTTGCAGGGGAGGGAGGGAGG + Intergenic
1078901017 11:15642953-15642975 TTCTGGAAGGGAACGGTAGGAGG + Intergenic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079076073 11:17386317-17386339 GTCTGGAAGGGGAGGAAGCAGGG - Exonic
1079571487 11:21949094-21949116 TCCTGGATGGGGAAGTTGGAGGG - Intergenic
1080617812 11:33960214-33960236 TTCTAGAAGGTCAGGGTGGGGGG + Intergenic
1080630502 11:34070637-34070659 TTCTGGAAGGCCAAGGTGGGTGG - Intronic
1081362477 11:42197472-42197494 TACTTGAGGGGGAGGATGGAAGG + Intergenic
1081554611 11:44146814-44146836 TTCCAGAAGGGGAAGGTTGAAGG + Intronic
1082013434 11:47466901-47466923 TCCTGGAAGGGGTGATTGGATGG - Intronic
1082020396 11:47528097-47528119 TTTTGGGAGGGGTGGGGGGATGG - Intronic
1083151536 11:60794677-60794699 TTTTGGAAGGGGCGGGGGAACGG + Intronic
1083330825 11:61897648-61897670 TTATGAAGGGGGAGGGAGGAAGG + Exonic
1083459452 11:62801047-62801069 TTTTTGAAGGGGTGGGTAGAGGG - Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083918285 11:65764588-65764610 TTCAGGAAGGGGAGAGAGGCTGG + Intergenic
1084376770 11:68783222-68783244 TTCTGGTTGGGCAGGGAGGAGGG - Intronic
1084839246 11:71831549-71831571 TCCCGGACGGGGAGGCTGGATGG - Intergenic
1085306306 11:75488020-75488042 GAATGGAAGGGGAGGCTGGATGG - Intronic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1087777149 11:102267013-102267035 TTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1088265832 11:107986746-107986768 TTCAGAAGGTGGAGGGTGGAAGG + Intergenic
1088352795 11:108909194-108909216 CCCTGGAAGGGAAGGGTGGCTGG + Intronic
1088415781 11:109587304-109587326 TTCTGGAAAGGAGGGGTGGCAGG + Intergenic
1088988754 11:114932269-114932291 TCCTGAGAGGGGAGGGTGAAAGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089512601 11:119009605-119009627 TCCTGGAACACGAGGGTGGAAGG - Intronic
1089588065 11:119522533-119522555 TTTTGGAAGGTGGGGATGGATGG + Intergenic
1090273762 11:125405493-125405515 TTTTGGAAGTGGGGGGTGCAGGG - Intronic
1090391157 11:126388573-126388595 TTCTGGAAGGCCAAGGTGGATGG - Intronic
1090424360 11:126596811-126596833 TTCTGGAAGACCAGGCTGGATGG - Intronic
1090830961 11:130420554-130420576 GTCTGGAAGGTGGGAGTGGAAGG + Intronic
1091151620 11:133334489-133334511 TACTTGATGGGGAGGGTGGGAGG + Intronic
1091412629 12:254133-254155 TCCTGGCAGCTGAGGGTGGAGGG + Intronic
1091979727 12:4855233-4855255 TTCAGGGAAGGGAGGGTGGTTGG + Intergenic
1092048795 12:5453357-5453379 TTAGGGAAGGGGAGGCAGGAGGG - Intronic
1092295904 12:7199803-7199825 TTCTGGACGGGGCGGCTGGCCGG + Intronic
1092662647 12:10755438-10755460 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
1095043006 12:37464887-37464909 TCCTTGGAGAGGAGGGTGGAGGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095559343 12:43547345-43547367 TACTGGAGGGGGAGGGGGAAAGG + Intronic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096379518 12:51144275-51144297 TTTTGGAAGGCTAAGGTGGAAGG - Intronic
1096625486 12:52892873-52892895 GTCGGGAAAGGCAGGGTGGAGGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098092302 12:66916479-66916501 TTCTGAAAGGGGTTGCTGGAAGG - Intergenic
1098311271 12:69151511-69151533 TTATTGAATGGGCGGGTGGATGG - Intergenic
1098384956 12:69908910-69908932 TTTTGAAGGTGGAGGGTGGAGGG - Intronic
1098938408 12:76506743-76506765 TCCTGGAAGGGGAAAGTGGCTGG + Intronic
1099214621 12:79838838-79838860 TTCTGCTAGGGCAGTGTGGAAGG + Intronic
1099355122 12:81624819-81624841 CTCAGAAGGGGGAGGGTGGAGGG + Intronic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1100911483 12:99368221-99368243 TACTAGAGGAGGAGGGTGGAAGG + Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101496631 12:105260602-105260624 TTCTGGAGGGTCACGGTGGATGG + Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1102393343 12:112567380-112567402 TTCTGGGAGGCCAGGGTGGGAGG + Intergenic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103200530 12:119084308-119084330 TTCTGGAAGGTGAGAGGGGAAGG + Intronic
1103254283 12:119527433-119527455 TGCTGGAAAAGTAGGGTGGAAGG + Intronic
1103657898 12:122488421-122488443 TTCTGGGAGGCCAAGGTGGAAGG - Intronic
1103775624 12:123364652-123364674 TCCGGGAGGGGGAGTGTGGAAGG + Intronic
1104365835 12:128175862-128175884 TTCTGCAGGGGCAGGGTGAAGGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104728977 12:131094722-131094744 TTCCAGAAGGAGAGGGTGGTGGG + Intronic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1105892175 13:24689638-24689660 TTCTGGAAGGGACCTGTGGAAGG + Intronic
1106133295 13:26956934-26956956 TTCGGGAAGGGGAGGGGAGGTGG - Intergenic
1106208029 13:27617636-27617658 TAGAGGAAGGGGAGGGTGAAGGG - Intronic
1107224394 13:38029843-38029865 TTCTGAAAGGGTAGAGGGGAAGG + Intergenic
1107306440 13:39025385-39025407 TTCTGGGAGGGAATGGTGCAAGG - Intronic
1108008027 13:45972436-45972458 CTCAGAAGGGGGAGGGTGGAAGG + Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108717839 13:53099455-53099477 GTCTGGAAGAGGATGTTGGAGGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110562507 13:76924314-76924336 TTCTGGAAGGATTGGGTGGATGG + Intergenic
1111209740 13:85062282-85062304 TTCTGGAAGGAGAGAGGGGCTGG - Intergenic
1112031337 13:95459343-95459365 CTCTGGTAGGGTAGTGTGGAAGG - Intronic
1112135775 13:96576150-96576172 TTCTGGAAGGGAACGGGCGAGGG + Intronic
1112167906 13:96939392-96939414 TCCTGGAAGAGGAAGGTTGACGG - Intergenic
1112232794 13:97606498-97606520 TCCTGGAAAGGGAGGGAAGAAGG - Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1114568214 14:23647716-23647738 TTCTGGATGTTGAGGGGGGAGGG + Intergenic
1114929024 14:27444070-27444092 TTTGGGAAGGGGAGGCAGGAGGG - Intergenic
1115012035 14:28559882-28559904 TTCTAGAATTGGAGTGTGGATGG + Intergenic
1115041544 14:28936114-28936136 TTCTGGATGGGCAGGTTGGTGGG + Intergenic
1115452709 14:33566451-33566473 ATTTGGAAGGGTGGGGTGGAAGG - Intronic
1115468623 14:33744542-33744564 TTCTGGGAGGCGAAGGTGGGAGG + Intronic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1115542007 14:34429567-34429589 TTCTGGAAGAGGAGGGATAATGG - Intronic
1115577542 14:34725674-34725696 TTTTGGGGGGGAAGGGTGGAGGG + Intergenic
1115724516 14:36198509-36198531 GTCGGGAGGGGGAGGGGGGAGGG + Intergenic
1115877724 14:37879461-37879483 TGCTAGAAGTGGAGGTTGGAAGG + Intronic
1116654043 14:47628729-47628751 TTCTTGAAGGGGAGTCTGGCTGG - Intronic
1117394985 14:55299940-55299962 TTCAGGAGGGGGAAGTTGGAGGG - Intronic
1117556039 14:56884924-56884946 TTCTGGAAGGAGAGGGATGGGGG - Intergenic
1117957060 14:61130969-61130991 TCCTGGAGGAGGAGGGAGGAGGG - Intergenic
1118077136 14:62311717-62311739 AGCTGGAAGGTGAGGGTGGGAGG + Intergenic
1118316607 14:64729730-64729752 GTCTGGGAGGGCAGGGTGCAGGG + Intronic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1118911986 14:70069303-70069325 TTCTGGCATGGGAGGGCCGAAGG - Intronic
1119666488 14:76488766-76488788 TTGTGGAAGGGGAGCCTTGAGGG - Intronic
1120510571 14:85408656-85408678 TCCTGGCAGGGGTGGGTGGTGGG + Intergenic
1120652081 14:87146665-87146687 TTCAGGCAGATGAGGGTGGAAGG - Intergenic
1120892880 14:89506041-89506063 TTCTGGACGGGGCGGCTGGCCGG - Intronic
1120994584 14:90407086-90407108 CCCTGGAGGGGGAGGGTGTAGGG - Exonic
1121310142 14:92931450-92931472 TTCTGGCTGGGGAGGCTGGCTGG - Exonic
1121336794 14:93082600-93082622 TTCTGGAAGGGTAGGAAGGCAGG - Intronic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1121618482 14:95330102-95330124 AGCTGGGAGGGAAGGGTGGAGGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122280392 14:100618784-100618806 TGCTGCCAGGGGAGGGTGGTGGG + Intergenic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122412034 14:101530510-101530532 TACAGGAATGGGAGGCTGGATGG - Intergenic
1122629001 14:103098953-103098975 TGCTGGAGGGCGAGGGTGGGTGG + Intergenic
1123042005 14:105494129-105494151 TTGTGGAAGGGAAGGGTGAGTGG - Intronic
1123115443 14:105892271-105892293 TTCGGGGAGGGAAGGATGGAGGG - Intergenic
1202941547 14_KI270725v1_random:152489-152511 TCCTTGGAGAGGAGGGTGGAGGG + Intergenic
1123666873 15:22614891-22614913 TCCTGGAGGAGGAGGTTGGAGGG + Intergenic
1123755179 15:23392303-23392325 CTCTGGAAGCTGAGGTTGGAAGG - Intergenic
1124320713 15:28709464-28709486 TCCTGGAGGAGGAGGTTGGAGGG + Intronic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1125843884 15:42833042-42833064 TACTGGACGGGGAGGATTGAAGG + Intronic
1126170689 15:45693044-45693066 TTCTGGGACTGGGGGGTGGAGGG - Intergenic
1126266159 15:46756173-46756195 CTCTGGTAGGGCAGTGTGGAAGG - Intergenic
1126406517 15:48328435-48328457 ATCTGGAAGGCTGGGGTGGAAGG + Intergenic
1126691028 15:51289085-51289107 TTGTGGAAGGACAGGGTGGTGGG + Intronic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127293409 15:57590279-57590301 TTTTGGAAGGGATAGGTGGATGG + Intergenic
1127943513 15:63725974-63725996 TTCTGGGGGGCGGGGGTGGAGGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128228218 15:66017567-66017589 TCCTGGGAGGGGAGGAAGGACGG - Intronic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129461072 15:75700353-75700375 TTCTGTCAGGGCCGGGTGGAGGG + Intronic
1129608687 15:77037091-77037113 TCCTGGAAGGGGAGGATGGCTGG + Exonic
1129723749 15:77891372-77891394 TTCTGTCAGGGCCGGGTGGAGGG - Intergenic
1129879860 15:78999362-78999384 AGCTGGAAGAGGAGGGTGCAGGG + Intronic
1130658097 15:85807125-85807147 TATTGGAAGGAGAGGGTGTAGGG - Intergenic
1130738987 15:86577937-86577959 TTCTGCTAGGGTAGTGTGGAAGG + Intronic
1130841046 15:87701506-87701528 TTCTGGAACAGGAGGGGAGAGGG - Intergenic
1131102258 15:89702021-89702043 TTCTCCAAGTGGAGGGTAGACGG - Exonic
1131283529 15:91039738-91039760 TTCTGGAAAGGGAGGGTCCCTGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132003117 15:98200109-98200131 TACTTGAAAGGGAGGGTGGGAGG - Intergenic
1132109567 15:99092642-99092664 TTCAGGAAGGTGGGAGTGGAGGG + Intergenic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132350456 15:101136645-101136667 TCCTGGAAGCGGAGGGTGGGGGG - Intergenic
1132356538 15:101174921-101174943 TTCTGGAAACGGAGCCTGGAAGG + Intergenic
1132458683 16:38577-38599 TTCTAGAAAGGGAGAGGGGATGG + Intergenic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133372083 16:5252829-5252851 TTCTGGAAGGGGGAGGTGGTGGG - Intergenic
1133474030 16:6102563-6102585 TGCTGGAAGGGGTGGGAGGGTGG - Intronic
1134104755 16:11477544-11477566 TTCTGGGTGGGGTGGATGGAAGG + Intronic
1134151085 16:11805371-11805393 TTCCTGAAGGGCAGGATGGAGGG + Intergenic
1134215810 16:12316277-12316299 TTCTGGGAGGCCAGGGTGGGTGG + Intronic
1134779392 16:16882014-16882036 TTCGGTGAGGGGAGGGAGGAGGG - Intergenic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135309206 16:21392120-21392142 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1136071837 16:27792037-27792059 TGGTGGAAGGGAAGGATGGAGGG - Intronic
1136148787 16:28332447-28332469 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136305949 16:29371250-29371272 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136609438 16:31357191-31357213 TTCCGGAATGTGAGGGTGGGAGG + Intronic
1137013147 16:35344417-35344439 TTCTGGGAGAGCAGTGTGGATGG - Intergenic
1138659381 16:58508570-58508592 TCCTGGAAGAGCAGGGTGGTGGG + Intronic
1139069421 16:63361974-63361996 TTATGGAATGGATGGGTGGATGG + Intergenic
1139282331 16:65781339-65781361 TTCTGGACCTGGAGGATGGATGG - Intergenic
1139552487 16:67682515-67682537 TTCTTAAAGGGGAGAGGGGAAGG - Intronic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139932551 16:70540302-70540324 TTCGGGAAGGCCAAGGTGGATGG - Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140003335 16:71048713-71048735 TACTTGAGGTGGAGGGTGGAAGG + Intronic
1141174467 16:81709925-81709947 TTCTGGGGGCGGAGGGGGGAGGG + Exonic
1141282844 16:82644564-82644586 TGCTGGAAGGGGAGGCTTTATGG + Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141820491 16:86442224-86442246 GTCTGGCAGGGCAGGGAGGACGG + Intergenic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1142600722 17:1052367-1052389 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600739 17:1052411-1052433 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600756 17:1052455-1052477 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600773 17:1052499-1052521 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600808 17:1052587-1052609 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600826 17:1052631-1052653 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600844 17:1052675-1052697 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600860 17:1052719-1052741 TTCCGGAAGGGGCTGGGGGACGG + Intronic
1142600877 17:1052763-1052785 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600894 17:1052807-1052829 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600911 17:1052851-1052873 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600929 17:1052895-1052917 TTCAGGAAGGGGCTGGGGGAGGG + Intronic
1142600945 17:1052939-1052961 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600961 17:1052983-1053005 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600978 17:1053027-1053049 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600995 17:1053071-1053093 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601013 17:1053115-1053137 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601031 17:1053159-1053181 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601049 17:1053203-1053225 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601066 17:1053247-1053269 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601083 17:1053291-1053313 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142666943 17:1468651-1468673 GTCAGGAAGTGGAGGGTTGATGG - Intronic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1143621782 17:8084911-8084933 CTCTGGCAGGGGTGGGTGCAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1145127544 17:20314682-20314704 TTTTGGGGGGGGAGGGGGGAAGG - Exonic
1145367650 17:22278291-22278313 TTGTGGAAGGGCAGGGTGGGGGG + Intergenic
1145809518 17:27756128-27756150 TGCTAGAAGGGGAAGGTGGCGGG + Intergenic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1145908988 17:28531945-28531967 TTCTGGAAGGGAAAGAGGGAGGG + Intronic
1145920134 17:28604150-28604172 TCCTGGAAGGGGCGGCTGGCCGG + Intronic
1146414597 17:32620284-32620306 TACTGCCAGGTGAGGGTGGAGGG + Intronic
1146426537 17:32744937-32744959 TACTGGTAGGGGATGCTGGAAGG + Intronic
1146456589 17:33014065-33014087 CTCTGGAAGGGAAGGGTTGGTGG + Exonic
1146497697 17:33337654-33337676 TTCTGGAGGGGCAAGGAGGATGG + Intronic
1146497750 17:33338030-33338052 TTCTGGAAGGGCAAAGAGGATGG + Intronic
1146497759 17:33338072-33338094 TTCTGGCAGGGCAGGGAGGATGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146497785 17:33338237-33338259 TTCTGGAAGGGCAAGGAGGCTGG + Intronic
1146581802 17:34045097-34045119 ATCTGGAAGGAAAGGGTAGATGG - Intronic
1146799640 17:35808437-35808459 TTCTTCAAGGGGAGAGTAGAAGG - Intronic
1146953199 17:36920818-36920840 TGTTGGGAGGTGAGGGTGGAGGG + Intergenic
1147136093 17:38434908-38434930 GGCTGGAAGGAGAGGCTGGAGGG + Intronic
1147250974 17:39152178-39152200 TGCTGGAAATGGGGGGTGGAGGG - Intronic
1147335324 17:39724017-39724039 TCCTAGCAGGAGAGGGTGGAGGG - Intronic
1147403053 17:40192393-40192415 TGCTGGAGGGTGAGGTTGGAAGG + Intronic
1147459233 17:40557890-40557912 TGCTGGCAGTGGAGGCTGGAAGG - Intronic
1147841486 17:43374972-43374994 CCCTGGAAGTGGATGGTGGATGG + Intergenic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148616371 17:49003769-49003791 TTCCAGACGGGGAGGGGGGAGGG + Intronic
1148647236 17:49225991-49226013 TTGTTGGAGGGGAGGGTGGTAGG + Intronic
1148686511 17:49503950-49503972 CTCTGGAAGGGAAGGGAGGCAGG + Intronic
1148784758 17:50140625-50140647 TTCAGGAAGGGGCGGGATGATGG + Intronic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1149434287 17:56620016-56620038 CTCTGGCAAGGGAGGGTGAACGG - Intergenic
1150255257 17:63739564-63739586 TAATGGAAGGGGAGGGCAGATGG + Intronic
1150808473 17:68337502-68337524 TCCTGGAAGGCGAAGGAGGAAGG + Intronic
1151128455 17:71870897-71870919 TTCTGGAAGGAAAGGGTGGGGGG + Intergenic
1151153321 17:72106493-72106515 TGCTGGAATGGGAGATTGGAGGG - Intergenic
1151331820 17:73414579-73414601 TTCTGGAGGGGGTGGGGAGAGGG - Intronic
1151890431 17:76948043-76948065 TTCAGGAAGGGGAAGAAGGAGGG - Exonic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152744920 17:82034110-82034132 CCCTGGAGGGGGAGGGTGGGGGG + Exonic
1152789436 17:82270948-82270970 TTCCAGAGGTGGAGGGTGGAAGG - Intronic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1152809687 17:82375590-82375612 TTCCAGAAGGGGACGGAGGAGGG - Intergenic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1153890633 18:9511082-9511104 CTCTGGAAGGCCAGGGTGGGTGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155358143 18:24973515-24973537 TGGTAGAAGGGAAGGGTGGAGGG - Intergenic
1155385841 18:25276223-25276245 TTCTGTCTGGGGTGGGTGGAGGG - Intronic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1155857482 18:30850949-30850971 CTCTGCAAGGGGAGGGTTTATGG + Intergenic
1156032716 18:32731480-32731502 TACTTGAGGGGGAGGGTGGGAGG + Intronic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1157215103 18:45775890-45775912 TTCTTGAAGGGGAGGGAGGGAGG + Intergenic
1157249789 18:46084812-46084834 TTCTGTCAGGGGTGGGAGGAAGG - Intronic
1157264745 18:46208709-46208731 ATCTGGGAGGTCAGGGTGGATGG - Intronic
1157311213 18:46554665-46554687 TGAGGGAAGGGGAGAGTGGAGGG + Intronic
1157472279 18:47999095-47999117 TTCTGGGAGGGGAGAATGGCAGG - Intergenic
1157496207 18:48159140-48159162 TTCTGGAAGGGTAGGGGTCATGG + Intronic
1157499496 18:48179815-48179837 TCCTTGAAGGGAAGGGAGGAAGG - Intronic
1157500709 18:48188675-48188697 TTCTGGAAGGTGATGGTGTTTGG - Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1158427598 18:57353310-57353332 TTCAGGAGGGTGAGGGTGGAGGG + Intronic
1158581423 18:58687299-58687321 TTCTGGATGTGGAGTGTGGAGGG + Intronic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159349251 18:67250406-67250428 TTCTGGATGATGAAGGTGGATGG + Intergenic
1159409698 18:68055226-68055248 TGCTGGAGGGGGAAGGAGGAAGG - Intergenic
1159449593 18:68583402-68583424 CACTGGTAGGGGAGGGTGGTAGG + Intergenic
1159502851 18:69296208-69296230 TTGTGGAAGGGTAGTGGGGATGG - Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1161611956 19:5248053-5248075 TTCTGGTAGGGCTGGGTGGAGGG + Intronic
1161821505 19:6533471-6533493 TTCTGGAGGGGGAGGGGAAAGGG - Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162105489 19:8367288-8367310 TTCTGGAGGGTGACGGGGGAAGG + Intronic
1163117016 19:15195218-15195240 TGCAGGGATGGGAGGGTGGAGGG + Intronic
1163428157 19:17250413-17250435 CGCTGGAAGGGGTGGGTGGCTGG + Exonic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164857700 19:31537849-31537871 TTCTGGAAGAAGAGAATGGAAGG - Intergenic
1165135776 19:33667481-33667503 TTCTGGAAGGCTGGGGTGGCAGG + Intronic
1165773147 19:38389768-38389790 TCCGGGAAGGGGTGGGTGGGGGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1166197306 19:41215600-41215622 TTTTGGGGGGGGAGGGGGGATGG + Intergenic
1166459229 19:42971572-42971594 TCTTGGAAAGGGAGGGAGGAAGG - Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166754266 19:45180684-45180706 TTCTGGAAGTGGAGCTAGGATGG - Exonic
1166877710 19:45907733-45907755 TTCTAGCTGGGGATGGTGGATGG + Intergenic
1166973834 19:46591283-46591305 GCCAGGAAGGGTAGGGTGGAGGG - Intronic
1166979701 19:46625237-46625259 TCCTGGATTGGGCGGGTGGACGG - Intergenic
1167141265 19:47652163-47652185 TTCAGGTATGGAAGGGTGGAGGG + Intronic
1167313984 19:48753236-48753258 TTCTGGAATTTGAGTGTGGACGG - Intronic
1167338068 19:48898715-48898737 TGTTGGAAGTGGAGAGTGGAGGG - Exonic
1167424906 19:49425182-49425204 TTCAGGTAGGAGAGGGTAGAGGG + Intronic
1167443185 19:49521776-49521798 TTCAGGAAGGGTAAGGTGGGAGG - Intronic
1167469033 19:49665251-49665273 TTCTGTAGGGGGACTGTGGAAGG - Exonic
1167616417 19:50536799-50536821 TTCTGGAAGGGTGGGAAGGAAGG + Intronic
1167622350 19:50567159-50567181 TTCCAGGAGGGGAGGGCGGAGGG + Intronic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1167830317 19:52014709-52014731 TCCTGGAAGGGGAGGGGTGCTGG - Exonic
1168189934 19:54730614-54730636 GCCAGGAAGGGAAGGGTGGAGGG - Intronic
1168202048 19:54822665-54822687 GCCAGGAAGGGAAGGGTGGAGGG - Intronic
1168206861 19:54856721-54856743 GCCAGGAAGGGAAGGGTGGAAGG - Intronic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
925038970 2:715430-715452 ATCTGGAAGGCGAGGGTGCATGG - Intergenic
925038981 2:715496-715518 ATCTGAAAGGTGAGGGTGCATGG - Intergenic
926213360 2:10888123-10888145 TTCAGGAGGGGGAGGTTGCAGGG - Intergenic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
927177666 2:20421950-20421972 TGGTGGAGGGGGAGGATGGATGG - Intergenic
927605647 2:24484044-24484066 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
928261754 2:29774281-29774303 TCTTGGCAGGGGAGGGTGGTTGG - Intronic
930230146 2:48835111-48835133 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
931273385 2:60722270-60722292 TCCTGGAATGGGAGGTTGCAGGG - Intergenic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
933089530 2:78103967-78103989 TTCTGCTGGTGGAGGGTGGAGGG - Intergenic
933335428 2:80952181-80952203 ATCTGAAAGTGGAGGGTGGGAGG - Intergenic
933508101 2:83204183-83204205 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
933770715 2:85742215-85742237 ATCTGAAAGGGGAGGGTGATCGG - Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
935499840 2:103825354-103825376 TCCTGATAGGGGAGGGAGGAGGG - Intergenic
935958306 2:108400122-108400144 AGCTGGAAGGGGAGGGGGTAAGG - Intergenic
936862350 2:117032764-117032786 TTCTGCTAGGGCAGCGTGGAAGG - Intergenic
937138962 2:119581624-119581646 TTCTGTCAGGAGAGAGTGGAGGG + Intronic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937496599 2:122426804-122426826 TTCTGGGAGGCCAAGGTGGAAGG - Intergenic
937551325 2:123095825-123095847 ATCCTGCAGGGGAGGGTGGATGG - Intergenic
937840289 2:126518420-126518442 TTCAGAAAGGGCAGAGTGGAGGG - Intergenic
937863856 2:126733312-126733334 TTCTGTGAGGGCAGGGAGGAGGG + Intergenic
937991289 2:127663838-127663860 CTCTGGATGGGGAGGTTGGGAGG - Intronic
938338058 2:130516660-130516682 GGCTGGAAGTGGAGGGTGTAGGG + Intergenic
938351780 2:130604078-130604100 GGCTGGAAGTGGAGGGTGTAGGG - Intergenic
938383389 2:130848888-130848910 TTCTGGAGCTGGAGGGTGGTGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939477307 2:142702695-142702717 TCCTGGAAGGGGCGGCTGGCCGG - Intergenic
941011782 2:160308285-160308307 CTCAGGAAGCTGAGGGTGGAAGG + Intronic
941153140 2:161940306-161940328 TTCTGGAGGGGAAGGGTGAAGGG - Intronic
941430558 2:165409105-165409127 TTCTGTTAGGGCAGTGTGGAAGG + Intergenic
942418153 2:175780449-175780471 TTCTGGAGTTGGGGGGTGGATGG - Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943247016 2:185467625-185467647 TTTTTGAGGGGGAGGGTGGCAGG + Intergenic
943345251 2:186731325-186731347 TTCTGGAAGGAGAGGGACTAGGG + Intronic
943832907 2:192485372-192485394 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
944209967 2:197197092-197197114 TTCTGGCTGGGGAGGGAGTAGGG - Intronic
944303961 2:198157811-198157833 TTCTGCTAGGGCAGTGTGGAAGG + Intronic
945286427 2:208087189-208087211 TTCTAAAAAGGGAGGTTGGATGG + Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
945592025 2:211745695-211745717 TTCTGGCGGTGGAGGGTGGGGGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946418632 2:219552756-219552778 TTCTAGAAAGGGGGCGTGGAGGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946549310 2:220783136-220783158 TTCTGTTAGGGGAGGGTTGTTGG + Intergenic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
946736757 2:222761567-222761589 TTTTGGAAGGCCAGGGTGGGAGG + Intergenic
947224444 2:227826429-227826451 TTATGGTAGGGCAGGGAGGAGGG - Intergenic
947275999 2:228393015-228393037 TACTAGAAGGGGAGAGAGGAAGG - Intergenic
947285317 2:228507552-228507574 TTGTGGAAGGGGAGTGGGTAAGG + Intergenic
947712812 2:232325710-232325732 TTCTGGAAGGTGATGCTGGCTGG + Intronic
947732497 2:232439153-232439175 TTCTGGAAGGTGATGCTGGCTGG + Intergenic
947753212 2:232543474-232543496 TTGAGGATGGGGGGGGTGGATGG - Intronic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
1168990903 20:2095124-2095146 TCCTGGGAGGGAAGGGTGGATGG - Intergenic
1169157144 20:3341339-3341361 TTCTTGCAGTGGAGGGTGGGAGG - Intronic
1169270056 20:4192349-4192371 TTTTGGAATGGGAGAATGGAGGG - Intergenic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1170209619 20:13835587-13835609 TTCAGGAAGGGGAGAGGGGCTGG + Intergenic
1170662101 20:18352140-18352162 ATCTGGAAGGAAAGGATGGAGGG - Intergenic
1170866893 20:20165505-20165527 TTCTGGAGGGGCAGGGTGGGTGG - Intronic
1170875263 20:20244274-20244296 TTCTGCTAGGGCAGTGTGGAAGG - Intronic
1171537429 20:25907641-25907663 TCCTTGGAGAGGAGGGTGGAGGG + Intergenic
1171803680 20:29653645-29653667 TCCTTGGAGAGGAGGGTGGAGGG - Intergenic
1171913661 20:30991304-30991326 TTTTGGGGGGGGAGGGGGGAGGG + Intergenic
1172080867 20:32339596-32339618 TTCTGGAAGGGCAGGGTTCATGG - Intergenic
1172265080 20:33604818-33604840 TTCTGGAAGGGTAGGGGAGAAGG - Intronic
1172497079 20:35395200-35395222 TTTTGGAAGGGGAGAGGGGCTGG - Intronic
1172720993 20:37000338-37000360 TTCTGGACGGGGCGGCTGGCCGG - Intronic
1172758609 20:37306089-37306111 ACCTGGAAGTGGAGGGTGGCAGG + Intronic
1172836590 20:37877287-37877309 TGCAGGCAGGGGTGGGTGGATGG - Intergenic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1172945061 20:38680919-38680941 TTCCTGAGAGGGAGGGTGGAAGG - Intergenic
1173167769 20:40697983-40698005 TTCTGCAAGGGGATGGCAGAGGG + Intergenic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173615338 20:44399892-44399914 GGCTGGAAGGGCAGGTTGGAGGG - Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1174224405 20:48985234-48985256 TTCTGGAATGGGTGGGTGGGTGG + Intronic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1174622693 20:51888317-51888339 TTCGGGAAGCCGAGGGCGGAGGG + Intergenic
1175097284 20:56551686-56551708 AGCTGGGAGGGGAGGGTGTACGG + Intergenic
1175261172 20:57675157-57675179 TTCTGGGCGGGACGGGTGGAGGG - Intronic
1175359109 20:58393545-58393567 TCATGGAAGGGGAGGGAGAAGGG - Intronic
1175843055 20:62042613-62042635 TGCTGGAAGGGGAGCGTGCAGGG - Intronic
1176043310 20:63079608-63079630 TCCTGGAGGTGGAGTGTGGAGGG + Intergenic
1176182551 20:63757820-63757842 CCCTGGACGGGGCGGGTGGAGGG - Intronic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182656 20:63758185-63758207 CTCTGGACGGGGCGGGTGGGGGG - Intronic
1176581618 21:8534445-8534467 TCCTTGGAGAGGAGGGTGGAGGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176688020 21:9871596-9871618 TTCTGGAAGTGGAGGGACAAGGG - Intergenic
1176709216 21:10135247-10135269 TTCTGGAAGGGGGAGGCTGAGGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177670232 21:24215019-24215041 TGCTGGAAGGGACGGGAGGAGGG + Intergenic
1178723045 21:35027116-35027138 ATCAAGAAGGGCAGGGTGGAGGG + Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179502165 21:41816663-41816685 TTCTGGCAGGAGCTGGTGGATGG - Intronic
1179515120 21:41900851-41900873 TTTTGGAAGGCCAAGGTGGATGG + Intronic
1179546547 21:42116016-42116038 TTCAGGAGGGAAAGGGTGGAAGG + Intronic
1179719411 21:43306784-43306806 TTCTGGGTGGGGCTGGTGGAGGG - Intergenic
1180002910 21:45003138-45003160 GCCTGGAAGGGGTGGCTGGAGGG - Intergenic
1180087684 21:45515405-45515427 TGCTGGAAGAGGTGGGTGGTGGG - Exonic
1180185212 21:46135875-46135897 TGCTGGGAGGGGAGGCTGGGAGG - Intergenic
1180264452 22:10511517-10511539 TCCTTGGAGAGGAGGGTGGAGGG - Intergenic
1180675056 22:17581165-17581187 TGCTGGCAGGCGAGCGTGGAGGG + Intronic
1180998166 22:19975756-19975778 TCCTGGAAGGGAAAGGTGGTGGG + Exonic
1181002827 22:19995848-19995870 TCCTTGTAGGGAAGGGTGGAGGG - Intronic
1181102467 22:20550602-20550624 TTCTGGCAGGGCAGCCTGGAAGG - Intronic
1181236669 22:21451124-21451146 ACCTCGAAGGGGAGGGGGGAGGG + Exonic
1181984367 22:26789387-26789409 GTCTGGAGGATGAGGGTGGATGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182497188 22:30717856-30717878 TTCTGACAGGCGAGGGTGGGCGG + Intronic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183514828 22:38259045-38259067 TCCTGGAAGAGGAGGGAGGTGGG - Intronic
1183790566 22:40065104-40065126 TTTTGGAGGGTGGGGGTGGAGGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184743364 22:46442208-46442230 TCCTGGAGGGGAAGGGTGGGGGG - Intronic
1184895196 22:47402673-47402695 TCCTGGAAAGGGTGGGTGGGGGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949662156 3:6291838-6291860 CTCTGCAAGGGCAGTGTGGAAGG - Intergenic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
949918573 3:8984170-8984192 TTCTGGAGGGAGTGGGTGAAGGG + Exonic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950955072 3:17044226-17044248 TTCTGGAGAGTGAGGGAGGAAGG + Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952096503 3:29960565-29960587 TTCTGCTAGGGCAGTGTGGAAGG - Intronic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952821687 3:37491567-37491589 TCCAGGAAGTGCAGGGTGGAGGG - Intronic
953040388 3:39250751-39250773 TCCTGGAAGGGGACTGTGGCTGG + Intergenic
953119576 3:40026809-40026831 TTCAAGAAGGGGAGAGTGGATGG - Intronic
953136889 3:40189493-40189515 GCCTGGAAGGGGAGGGGAGAGGG - Intronic
953544533 3:43854657-43854679 TGCTTGAAAGGGAAGGTGGAAGG + Intergenic
954672840 3:52299763-52299785 TTCGGGAAGGGGATGGTTGATGG + Intergenic
954881654 3:53840054-53840076 TTCAGGAAGGGAAGGGAGGATGG + Intronic
954996724 3:54888473-54888495 TTTCTGAAGTGGAGGGTGGAGGG + Intronic
956269208 3:67432025-67432047 TGCAGGAAGGGGATGATGGATGG + Intronic
956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG + Intergenic
956722015 3:72126351-72126373 TTCTTGAAGGGGAATCTGGAAGG - Intergenic
956743094 3:72290138-72290160 TTCTGGAATGGGAGGTTTAAGGG + Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957576501 3:82014916-82014938 TTCTGCTAGGGCAGTGTGGAGGG + Intergenic
959250662 3:103939442-103939464 TTTTGGAAGGGTAGGGAGGAGGG - Intergenic
959838595 3:110949113-110949135 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
959996800 3:112689162-112689184 TCCTGGAAGGAGAGGGAGAAAGG - Intergenic
960350324 3:116585236-116585258 TAATGGAAGGAGAGGGTGCAAGG + Intronic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
960907975 3:122620721-122620743 GCCTGGGAGGGGAGGGTGGGAGG + Intronic
961013060 3:123448599-123448621 GTCTCCAAGGGGAGGGCGGACGG + Exonic
961103108 3:124218702-124218724 TTCTGGAGAGGGAGGGCGGGAGG + Intronic
961448542 3:126992216-126992238 TCCTGGAGGGTGTGGGTGGAGGG + Intronic
961507311 3:127378578-127378600 TTCTGGAAGGGGTGGGGGTGAGG - Intergenic
961673195 3:128549513-128549535 TTCTGGAAAGGCAGCGCGGAGGG + Intergenic
962816054 3:139001845-139001867 GGCTGGAGGAGGAGGGTGGATGG - Intergenic
962926583 3:139999253-139999275 TACTGGAAAGGGAGGGAGGGAGG - Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963332865 3:143935214-143935236 TTCTTGAAGTGGAGGCTGGCTGG + Intergenic
963706845 3:148698316-148698338 TTCTGGAATGGGAGGGAACAAGG + Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964492840 3:157255357-157255379 TTCGGGGAGTTGAGGGTGGAAGG + Intergenic
964884791 3:161469346-161469368 TCCTGGAAGGAGAGGATTGAAGG + Intergenic
965572907 3:170189437-170189459 TTCTGGAATGGGAGGATGGGAGG - Intergenic
965596969 3:170419613-170419635 TTCGGGAAGCGGACGGTGGAAGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966446554 3:180007562-180007584 TTCTGCTAGGGCAGTGTGGAAGG - Intronic
967253512 3:187566927-187566949 TTCTGCAAGGGTAGGGTGCAAGG + Intergenic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
968051272 3:195656676-195656698 TCCCGGAGGGAGAGGGTGGAGGG + Intergenic
968104552 3:195991663-195991685 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968302843 3:197629246-197629268 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
970046314 4:11858819-11858841 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
970099339 4:12503027-12503049 CTCTGGTAGGGCAGTGTGGAAGG - Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970717059 4:18938736-18938758 TGGTGGAAGGTGGGGGTGGAAGG - Intergenic
970721818 4:18997208-18997230 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971037144 4:22706080-22706102 TTCTGGATGGGGAGAGAGGCAGG + Intergenic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971858904 4:32079285-32079307 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
972050585 4:34727774-34727796 TCCTGGAGGAGGAGGGTGGCTGG + Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973657493 4:53064268-53064290 TACTAGAGGGGGAGGGTGGAAGG - Intronic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974452122 4:62078460-62078482 TGCATGAAGGGGAGGGTGGCAGG - Intergenic
975327846 4:73080102-73080124 TTTGGGAGGGGGAGGGGGGATGG - Intronic
975614594 4:76234120-76234142 GGCAGGGAGGGGAGGGTGGAGGG + Intronic
976217556 4:82729331-82729353 TTCTGGAGGAGGAGGGAGGCTGG + Intronic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976666159 4:87594906-87594928 TTCTGGAGGTGGAGGAGGGAGGG + Intergenic
976787149 4:88834905-88834927 TGCGGGAAAGGGAGGGTGAAGGG - Intronic
977132006 4:93251662-93251684 GCCTGGAAGTGGAGGGTGGTGGG - Intronic
977294197 4:95193038-95193060 CTCTTGAAGGGAAGGCTGGAAGG + Intronic
977453942 4:97234047-97234069 TTCTGGAAGCTGGGGGTCGAGGG + Intronic
977903862 4:102453980-102454002 TTCAGGAAGGGGAGCAGGGAGGG + Intergenic
978287693 4:107098272-107098294 TGCTGCCAGGGGATGGTGGAGGG - Intronic
978482899 4:109214715-109214737 TTCTGGAAGCACAGGGTAGATGG - Intronic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
978617190 4:110609848-110609870 TTCTGGCAGGGGATGGAGGGTGG - Intergenic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
979182866 4:117753321-117753343 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
980202788 4:129677396-129677418 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
980478633 4:133355821-133355843 TTCTGGAAGGGGTGGGGGAAGGG - Intergenic
980590768 4:134885135-134885157 TTTTGGCAGGGTAGGGTGGGGGG - Intergenic
980654046 4:135759294-135759316 CTCTGCTAGGGCAGGGTGGAGGG - Intergenic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981055936 4:140361418-140361440 TTTTGGAAGGCCAGGGTGGGAGG + Intronic
981124191 4:141087135-141087157 TACTTGAGGGGGAGGGTGGGAGG - Intronic
981268631 4:142817973-142817995 TTCTAGAAGTGGAGAGTGAAAGG + Intronic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981751436 4:148095786-148095808 GGCTGGGATGGGAGGGTGGAGGG + Intronic
981829963 4:148988062-148988084 AGTTGGAAGGGGTGGGTGGAAGG + Intergenic
981993715 4:150954163-150954185 TTCTGGACGGGGCGGCTGGCCGG - Intronic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
983247005 4:165298937-165298959 TTCTGGGGGGGGAGGGGGGGCGG - Intronic
983324803 4:166239930-166239952 TACTAGAGGGGGAGGGTGGGGGG + Intergenic
983442832 4:167809503-167809525 CTCTGGAGGTGGTGGGTGGAAGG - Intergenic
983855018 4:172633085-172633107 TTCTGCTAGGGCAGTGTGGAAGG + Intronic
983941551 4:173538511-173538533 GTCTGGGAGGTGAGGGTGGGAGG - Intergenic
984029631 4:174586832-174586854 TTCTGGACGGGGCGGCTGGCCGG + Intergenic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984216737 4:176922578-176922600 TTATTGAAGGGTAGGGAGGACGG - Intergenic
984234742 4:177142372-177142394 TTCTGATAGGGGAGTGCGGAAGG + Intergenic
984237032 4:177171991-177172013 TACTAGAAGGGGAGGGTGGGTGG + Intergenic
985362163 4:189187127-189187149 TCCAGGAAGTGGAGGTTGGATGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986363429 5:7004512-7004534 TCCTGGAAGGGGAGTGTTCATGG + Intergenic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986533412 5:8761926-8761948 TTCTGCCAGGGCAGTGTGGAAGG + Intergenic
986837142 5:11651421-11651443 TTCTACTAGGGGAGTGTGGAGGG + Intronic
986970847 5:13334731-13334753 TACTGGAAGCAGAGGGTGGGAGG - Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987593494 5:19964335-19964357 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
987593984 5:19971688-19971710 TTCCGAAGGTGGAGGGTGGAAGG + Intronic
987619933 5:20327792-20327814 TTCTGGGAGGGCAAGGTGGGAGG + Intronic
987959981 5:24793821-24793843 TTCTGGAAGGTCAGGATGTATGG - Intergenic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
988649444 5:33131957-33131979 CTCTGGTAGGGCAGTGTGGAAGG + Intergenic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
989174538 5:38510373-38510395 TTCTGGAGTGGGGGGGTGGGAGG - Intronic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990698911 5:58454228-58454250 TTCCTGAAGGGGAGGGAGAAGGG - Exonic
990906654 5:60810789-60810811 TTCTTGTAGGGTAGGGTGGAAGG + Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
992024361 5:72655980-72656002 TTCTTGGAGGGGAGGGAGGGAGG - Intergenic
992461691 5:76966464-76966486 TGGTGGAAGGGGAGGGTTGTAGG + Intronic
993427660 5:87788141-87788163 TTCTGGGGGGGCAGGGTGGGGGG + Intergenic
994297277 5:98105744-98105766 TGCAGGGAGGGGAGGGTGCAAGG + Intergenic
994524222 5:100882943-100882965 CTCTGCAAGGGCAGTGTGGAAGG + Intronic
994676911 5:102834755-102834777 ACCAGGAAGGGAAGGGTGGAGGG + Intronic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995775056 5:115716206-115716228 TACTTGAGGGGGAGGGTAGAAGG - Intergenic
996215008 5:120855966-120855988 TTCAGGATGGGGAGTGTGGTGGG - Intergenic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997384405 5:133461278-133461300 TTATGACAGGGGAGGATGGATGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998309764 5:141117003-141117025 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
998380905 5:141724693-141724715 TTCTGCTAGGGCAGTGTGGAGGG - Intergenic
998500614 5:142629405-142629427 ATTTGGAAGGCCAGGGTGGAAGG - Intronic
999221732 5:149985143-149985165 TTCTAGAAGGGGAGGGTCACAGG + Exonic
999669352 5:153945081-153945103 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
1000305635 5:159991955-159991977 TTCTGAAAGGCCAGTGTGGATGG + Intergenic
1000522855 5:162319093-162319115 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
1001214915 5:169846848-169846870 CTCAGAAGGGGGAGGGTGGAAGG - Intronic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001930285 5:175668132-175668154 TTCTGGAAGGGGAAGGACCAGGG + Intronic
1002310332 5:178310106-178310128 TCCGGGAAAGGAAGGGTGGAAGG - Intronic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002617685 5:180465846-180465868 TTCTGGGTGGGGAAGGTGAAAGG - Intergenic
1003053137 6:2797628-2797650 TTCTGGGAGGGGAGCAGGGAGGG - Intergenic
1003134142 6:3419900-3419922 TTCAGGAGAGGGAGGATGGATGG - Intronic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003286038 6:4734645-4734667 TTCAGGAAGGGGAGGGCACAGGG + Intronic
1003294735 6:4815175-4815197 TTCTGGAAGGTTAGGGTTGAGGG - Intronic
1003749884 6:9043338-9043360 CTCAGAAAGGGGAGAGTGGAAGG - Intergenic
1003837559 6:10088029-10088051 CTCAGGAAGGGGTGGGTGGGAGG - Intronic
1003851457 6:10227005-10227027 TTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1004037877 6:11941664-11941686 TTCAGAAGGGGGAGGCTGGAAGG - Intergenic
1004245646 6:13972821-13972843 TTCTGCTAGGGCAGTGTGGAAGG + Intronic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1004924616 6:20404170-20404192 TGCTGGAGGGGGAGGGGGGTGGG + Intronic
1005252569 6:23964250-23964272 TTCTAGAAGAGGAGTGTGGGAGG - Intergenic
1005348351 6:24911170-24911192 TGCTGGGAGGGGAGGGCGGGTGG + Intronic
1005694532 6:28339299-28339321 TTTTGGCAGGGGAGTGGGGAAGG + Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006054495 6:31373354-31373376 TGGTGGCAGGGGAGAGTGGAAGG + Intergenic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006380041 6:33692113-33692135 TTATGGAATGGGAGGGTGAGGGG - Intronic
1006479777 6:34282675-34282697 GGCAGGAAAGGGAGGGTGGAAGG + Exonic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1007520938 6:42451645-42451667 TTCTGGCCGGGGAGGGCGCATGG - Intronic
1007704206 6:43781173-43781195 GTCTGGAAGCTGAGGGTGGTGGG + Intronic
1007832471 6:44649017-44649039 CCCTGGACTGGGAGGGTGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009833897 6:68972459-68972481 TGCAGGAGGGGGAGGTTGGATGG - Intronic
1009941939 6:70300643-70300665 TCCTGGAAGGGGTGGATGCAAGG + Intronic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1011137828 6:84118433-84118455 TACTGGCAGGTGAGGGTGGCTGG + Intergenic
1011236918 6:85228274-85228296 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011748436 6:90431741-90431763 TTCTTGAAGGAGGGGGTGGAGGG - Intergenic
1012580195 6:100859166-100859188 TTCCAGAAGAGGAGGCTGGATGG - Intronic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1012715153 6:102659707-102659729 GACTAGGAGGGGAGGGTGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013656324 6:112250649-112250671 TTCTGACAGGGCAAGGTGGAAGG - Intronic
1013984798 6:116177855-116177877 TACTGGAAGGGCAGGGAGGTTGG + Intronic
1014223914 6:118826242-118826264 TTCAGGAAAGGAAGTGTGGAGGG + Exonic
1014621676 6:123674872-123674894 TTCTGATAGGGGAGTGTGGAAGG - Intergenic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1015013166 6:128376181-128376203 TTCTGCTAGGGAAGTGTGGAAGG - Intronic
1015638850 6:135308477-135308499 TTTTGGGAGGCCAGGGTGGATGG - Intronic
1015674212 6:135726343-135726365 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1015878405 6:137846866-137846888 TCATGGCAGGGGAGGGTGGAGGG + Intergenic
1016068452 6:139708336-139708358 TTTTGGAATGGGATGGTGGTAGG + Intergenic
1016074319 6:139778001-139778023 TAATGGAAGGGGAGGGGGCAAGG + Intergenic
1016315827 6:142785550-142785572 TTCTGGAAGGGAAGGGAGGTTGG - Intronic
1016533465 6:145084669-145084691 TTCTGGAAGGTGAAGGTGAGTGG + Intergenic
1017006348 6:150030268-150030290 TTCTAGAAAGGGAAGGTGGGAGG + Intergenic
1017059623 6:150469975-150469997 TCCTGGAAGAGGTGTGTGGATGG - Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017869697 6:158476535-158476557 ATCTCGAAGGCGAGGGAGGATGG - Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019220758 6:170470731-170470753 TTCAGGAAGGAGAGGGGAGAGGG + Intergenic
1019319317 7:408408-408430 TTCATGAATGGGTGGGTGGATGG - Intergenic
1019319593 7:409544-409566 TTAGGGAGGGGGAGGCTGGAGGG - Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019606598 7:1913291-1913313 TTCTGGGCGGGGTGGGTGCAGGG + Intronic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020129881 7:5553690-5553712 TTCGGGAAGGTGAGGCAGGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020788325 7:12595000-12595022 TTCGGGAAGGGGAGGTTGGCTGG + Intronic
1021594401 7:22299775-22299797 TTAAGGTGGGGGAGGGTGGAGGG - Intronic
1021838633 7:24704929-24704951 TTTTGGGAGGGTAAGGTGGAAGG - Intronic
1022274404 7:28841756-28841778 TTCTGGGAGGGAAGGAGGGATGG + Intergenic
1022449577 7:30502750-30502772 TGGTGGCAGGGCAGGGTGGATGG - Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1023022648 7:36024081-36024103 CTCTGGAAGGCCAGGGTGGGAGG - Intergenic
1024247494 7:47481361-47481383 TTCTGGAAGGGGAGGCCCCATGG - Intronic
1024517628 7:50272830-50272852 TTCTGGGAGGGGAGGGTAACAGG + Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024930362 7:54662670-54662692 CTCTGGAACGCGACGGTGGAAGG - Intergenic
1025288907 7:57694470-57694492 TCCTTGGAGAGGAGGGTGGAGGG + Intergenic
1026290569 7:69002193-69002215 TATTGGAAGTGGAGAGTGGATGG + Intergenic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1028471558 7:91211921-91211943 TTCTGGAACGGGAGAGTGCATGG + Intergenic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029012554 7:97277684-97277706 TTCTGGGAGGCCAAGGTGGATGG + Intergenic
1029440341 7:100583744-100583766 TTCTGGAGAGGGTGGGGGGATGG + Intronic
1029471719 7:100758780-100758802 TTCTGTAAGGTGAGGGTTGAAGG + Intronic
1029483598 7:100826819-100826841 TGCTGGAACGGGAGGGGGGCGGG - Intronic
1029551541 7:101239448-101239470 TTCAGGAAAGGGAGGAAGGAAGG + Intronic
1030036224 7:105410732-105410754 TCCTGGACGGGGAGGCTGGCCGG + Intergenic
1030626219 7:111848833-111848855 TGGTGGAAGGGGAGGGTTGTAGG - Intronic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1031141681 7:117949738-117949760 TTCCTGAAGGGGGAGGTGGAGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031640566 7:124158700-124158722 TACTTGAAGGGGAGGGTGTGAGG + Intergenic
1031725729 7:125235713-125235735 TCCTTGAAGGGGAGGATAGAAGG - Intergenic
1031831935 7:126638553-126638575 TACTGGAAGGGGATGCTGGGTGG + Intronic
1032291104 7:130591062-130591084 TTCTGGACGGGGCGGCTGGCCGG - Intronic
1032563403 7:132915364-132915386 TTCTGGAAGTGGCATGTGGAGGG + Intronic
1033217447 7:139503598-139503620 GTCTGGAATGGGAGGGGGCATGG + Intergenic
1034504588 7:151477664-151477686 TTCTGGGAGAAGAGGATGGATGG + Intronic
1034510437 7:151530066-151530088 TTCTGGAAGCTGAGGTGGGAGGG - Intergenic
1034906813 7:154956349-154956371 TTCTGGAAGTGGGGAATGGAAGG + Intronic
1034945652 7:155260206-155260228 GGCTGGAGGGGGAGAGTGGAAGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035062157 7:156077369-156077391 TTTTGGAAGGGGAGCCTGGTGGG - Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1035842669 8:2829154-2829176 TTCTGGGGAGGGTGGGTGGATGG + Intergenic
1036470403 8:9047737-9047759 TGTTGGAAGGGGAGAGGGGAGGG - Intronic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036798702 8:11773909-11773931 TCTTGGAAGGGGAGAGTAGAAGG - Intronic
1036928279 8:12928652-12928674 ATCTCGAAAGGGAGTGTGGAAGG + Intergenic
1037732507 8:21539535-21539557 TGTTGGAGGGGGAGGGGGGAGGG + Intergenic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038885170 8:31655430-31655452 TTCTGTTAGGGTAGGGAGGAGGG + Intronic
1039382645 8:37100331-37100353 TACTGAAAGGAGTGGGTGGAGGG - Intergenic
1039411575 8:37359588-37359610 CTCTGGAAGGGTGTGGTGGATGG - Intergenic
1039447716 8:37646084-37646106 TGCTGGAGGGAGAGGGAGGACGG + Intergenic
1039454838 8:37699492-37699514 GTCTGGAAGGTGACGGTAGACGG - Exonic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040551581 8:48442002-48442024 TCCTGGAATGGGGGAGTGGAGGG + Intergenic
1040592290 8:48804870-48804892 GCCTTGTAGGGGAGGGTGGAGGG - Intergenic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1042589713 8:70385668-70385690 TTTTGGAAGGCCAAGGTGGAAGG - Intronic
1042619542 8:70690252-70690274 TACTTGAGGGGGAGGGTGGAAGG - Intronic
1042784060 8:72527032-72527054 TTTTGGAAGGGGAGATGGGAAGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043394326 8:79822010-79822032 TTTTGGAAGAGCAGAGTGGAGGG - Intergenic
1043633027 8:82360878-82360900 TTCAGGAAGGTGAGGGTGAATGG - Intergenic
1044125282 8:88452125-88452147 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
1044214029 8:89585987-89586009 TACTTGAGGGGGAGGGTGGGAGG - Intergenic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1045067244 8:98459920-98459942 TTCTGGTAGGGCAGTGTGGAAGG + Intronic
1046137803 8:110052533-110052555 CACTGGAAGGGGAGAGTGTAAGG + Intergenic
1047465799 8:125112734-125112756 TTGGGGAAGGGAAGGGTGGGAGG + Intronic
1047528445 8:125654114-125654136 CTCTGGTAGGGGAGTGAGGAAGG + Intergenic
1047862979 8:128989396-128989418 TCCTTGAAGGAGGGGGTGGAAGG - Intergenic
1048658597 8:136571504-136571526 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
1048729172 8:137418713-137418735 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049575281 8:143386972-143386994 TGGTGGAAGGGGACGGTGGTTGG - Intergenic
1049602386 8:143513970-143513992 TTCAGAAAGGGGCTGGTGGAGGG - Intronic
1049758407 8:144320946-144320968 TCCAGGGAGGGCAGGGTGGAGGG - Intronic
1049795645 8:144496196-144496218 TTCTGGAAAGGGTGGGTGGGAGG + Intronic
1050717048 9:8541610-8541632 CACTGGAAGGCCAGGGTGGAAGG - Intronic
1050867516 9:10521652-10521674 TTGTCGAAGGTTAGGGTGGATGG - Intronic
1050918979 9:11175146-11175168 TTCTTGGAGGGGAGGATGCAGGG - Intergenic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051414230 9:16821848-16821870 TTCTGGAAGGCCAAGGCGGACGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051646965 9:19278859-19278881 TTCTGGGGGGGCAGAGTGGAGGG - Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1052099140 9:24422350-24422372 TTCATGAAGGTGAGGGTGGCGGG - Intergenic
1052607071 9:30718073-30718095 TACTAGAATGGGAGGGTGGGAGG - Intergenic
1052782541 9:32795918-32795940 TTCTGATAGGGCAGTGTGGAAGG - Intergenic
1053350652 9:37411398-37411420 TTCAGGGAGGGGAGGAGGGAAGG + Intergenic
1054959910 9:70956638-70956660 TTCTGGGAGGCCAGGGTGGGAGG + Intronic
1054978109 9:71171873-71171895 TTTTGGAGGGGGAGGGTGTTAGG + Intronic
1055298193 9:74854920-74854942 TTCTGGGAGGCCAAGGTGGATGG - Intronic
1056767867 9:89455730-89455752 GTCTGGAAAGTGAGGGAGGAAGG - Intronic
1056791747 9:89630236-89630258 TTCTGGAAAAGGAGGAGGGATGG - Intergenic
1056844512 9:90025574-90025596 TTCTGGGAGGAGTGGGAGGAAGG + Intergenic
1057221378 9:93259559-93259581 TTCAGGAAGGTGGGGCTGGAGGG - Exonic
1058223028 9:102326018-102326040 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
1058283733 9:103150484-103150506 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1059428983 9:114238748-114238770 TTCTGGCCCGTGAGGGTGGAAGG + Intronic
1059586981 9:115617700-115617722 TTATGGAAGGACAGGGTGAAGGG - Intergenic
1060205972 9:121683076-121683098 TCCTGGAAGGGAAGGAGGGAAGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1060824360 9:126679490-126679512 TGGTTGAAGGGGTGGGTGGATGG + Intronic
1061144324 9:128788313-128788335 TTCTGGAAGGGGAGATAGGGCGG - Exonic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061402975 9:130378427-130378449 GCCGGGAGGGGGAGGGTGGAAGG + Intronic
1061640332 9:131949264-131949286 TTGTGAAAGGGGAGGATGGCGGG + Intronic
1061792658 9:133066713-133066735 AACGGGAAGGGGAGGGTGGGAGG + Intronic
1061905732 9:133695965-133695987 TTCTGGAAGAGTAGAGAGGAAGG + Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062088419 9:134661017-134661039 TTCTTTTAGGGGAGGATGGAAGG + Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062615641 9:137394567-137394589 TTAGGGAAGCGGAGGCTGGAAGG - Intronic
1202793976 9_KI270719v1_random:104217-104239 TTCTGGAAGGGGGAGGCTGAGGG + Intergenic
1185482997 X:461343-461365 TGCGGGAAGGGCAGGCTGGACGG + Intergenic
1185586104 X:1243098-1243120 TCCTGGGCGGGGAGGGTGGGGGG - Intergenic
1185611514 X:1396129-1396151 TTCTGGAATGGATGGGTGGATGG + Intergenic
1185785902 X:2890648-2890670 TTTAGGAAGGGGAGGGCGGGGGG + Intergenic
1185930315 X:4195596-4195618 TTCTGGGAGGGAGGGGTGAAAGG + Intergenic
1186185808 X:7018706-7018728 TCTTGGAAAGGGAGGGAGGAAGG - Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186546880 X:10459169-10459191 TCCTGGTAGGGTGGGGTGGAGGG + Intronic
1186558033 X:10581511-10581533 TTATGGAAGGACAGGGTGGTAGG + Intronic
1186653249 X:11584926-11584948 TTCTGAGGGTGGAGGGTGGAGGG - Intronic
1186853391 X:13602232-13602254 TTCTGGAGGGGGATGGAGGGAGG + Intronic
1187019415 X:15364715-15364737 TGCTGAGAGAGGAGGGTGGAAGG + Intronic
1187468679 X:19548872-19548894 TTGTGGAAGGTGAGCTTGGAGGG + Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1187975711 X:24702747-24702769 TTTTGGAAGGGGATGGATGAGGG + Intronic
1188997625 X:36905031-36905053 TTCTGCTAGGGCAGAGTGGAAGG + Intergenic
1189174733 X:38944728-38944750 GTCAGGAAGGGGAGGCTGAATGG - Intergenic
1189416968 X:40824003-40824025 TTCTGGAGAGGGAGGGAGCAAGG - Intergenic
1189503051 X:41582554-41582576 TTCTGGGAGGCCAAGGTGGACGG - Intronic
1190065563 X:47239485-47239507 TAATGGATGGGGAGGGTGCATGG + Intronic
1190246076 X:48691235-48691257 GCCTGGAAGAGGAGAGTGGAGGG - Exonic
1190443915 X:50503905-50503927 TTCTGGGAGGAGAAGATGGAAGG + Intergenic
1190712008 X:53078214-53078236 ACTTGGAAGGGGAGGGTGCATGG - Exonic
1191025642 X:55909955-55909977 TTCTGCACAGGGAGGGTGGCAGG + Intergenic
1191704377 X:64079001-64079023 TGCCGTAGGGGGAGGGTGGAGGG - Intergenic
1191778371 X:64843050-64843072 TTCAGGAAGGGGAGAGTGGCTGG - Intergenic
1193085783 X:77447212-77447234 TTTTGGGAGAGGGGGGTGGAGGG - Intergenic
1193460521 X:81786416-81786438 CTCTGCTAGGGCAGGGTGGAAGG - Intergenic
1193470941 X:81902564-81902586 CTCAGAAGGGGGAGGGTGGAAGG - Intergenic
1194329809 X:92567839-92567861 TGCTGGAGGAGGAGGGTGGTGGG + Intronic
1194449246 X:94022832-94022854 TCCTGGAAGGAGAGTGGGGAGGG + Intergenic
1194560337 X:95411947-95411969 TTCTGCTAGGGCAGTGTGGAAGG + Intergenic
1195047055 X:101063731-101063753 GTCTGGTGGTGGAGGGTGGAGGG - Intergenic
1195283118 X:103356693-103356715 ACCTGGAGGTGGAGGGTGGAGGG - Intronic
1195316934 X:103688163-103688185 ATCAGAAAGGGGAGGGGGGAGGG - Intergenic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195595187 X:106680871-106680893 AGCAGGAAGTGGAGGGTGGACGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195778992 X:108439912-108439934 TTTGGGGAGGGGAGGGGGGAAGG + Exonic
1195803388 X:108736388-108736410 TTCAGGAAAGGGAGGGTTGGGGG + Exonic
1196833022 X:119791252-119791274 TTCTGGAGGCGGGGGGTGGGAGG - Intronic
1196898072 X:120357675-120357697 TTTTGGGAGTGGAGGGTGTAGGG - Intergenic
1197387708 X:125821449-125821471 TTCTGCTAGGGCAGTGTGGAAGG - Intergenic
1197642900 X:128986240-128986262 CTCTGCAAGGGCAGCGTGGAAGG + Intergenic
1198711329 X:139507746-139507768 CTCTGGTACGGGAGGGTGGCAGG + Intergenic
1199015376 X:142808125-142808147 TCCTGCAAGGGCAGTGTGGAAGG - Intergenic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1199874784 X:151921177-151921199 TTCTGCCTGGTGAGGGTGGAGGG - Intronic
1200223044 X:154401409-154401431 TTCTAGAAGGGGTGGGGGCATGG - Exonic
1200638511 Y:5687021-5687043 TGCTGGAGGAGGAGGGTGGTGGG + Intronic