ID: 914993103

View in Genome Browser
Species Human (GRCh38)
Location 1:152515480-152515502
Sequence CAGCAGGAGGAGGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4868
Summary {0: 1, 1: 5, 2: 88, 3: 920, 4: 3854}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993103_914993118 19 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993103_914993111 -10 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993103_914993115 1 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993103_914993112 -9 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993103_914993117 10 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993103_914993113 -8 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993103 Original CRISPR CAGCAGGAGGAGGAGGAGGC GGG (reversed) Exonic
Too many off-targets to display for this crispr