ID: 914993111

View in Genome Browser
Species Human (GRCh38)
Location 1:152515493-152515515
Sequence CCTCCTGCTGCGGCTCCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 400}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993098_914993111 2 Left 914993098 1:152515468-152515490 CCCACCCCGGCGCCCGCCTCCTC 0: 1
1: 0
2: 7
3: 61
4: 743
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993091_914993111 20 Left 914993091 1:152515450-152515472 CCGTGTCCCGCCCCGGCGCCCAC 0: 1
1: 0
2: 3
3: 37
4: 400
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993094_914993111 13 Left 914993094 1:152515457-152515479 CCGCCCCGGCGCCCACCCCGGCG 0: 1
1: 0
2: 15
3: 87
4: 671
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993099_914993111 1 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993089_914993111 26 Left 914993089 1:152515444-152515466 CCCGCTCCGTGTCCCGCCCCGGC 0: 1
1: 0
2: 3
3: 50
4: 409
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993093_914993111 14 Left 914993093 1:152515456-152515478 CCCGCCCCGGCGCCCACCCCGGC 0: 1
1: 1
2: 22
3: 295
4: 1580
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993095_914993111 10 Left 914993095 1:152515460-152515482 CCCCGGCGCCCACCCCGGCGCCC 0: 1
1: 2
2: 10
3: 103
4: 902
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993102_914993111 -4 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993103_914993111 -10 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993100_914993111 -2 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993087_914993111 27 Left 914993087 1:152515443-152515465 CCCCGCTCCGTGTCCCGCCCCGG 0: 1
1: 0
2: 2
3: 35
4: 250
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993097_914993111 8 Left 914993097 1:152515462-152515484 CCGGCGCCCACCCCGGCGCCCGC 0: 1
1: 0
2: 14
3: 153
4: 1145
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993090_914993111 25 Left 914993090 1:152515445-152515467 CCGCTCCGTGTCCCGCCCCGGCG 0: 1
1: 1
2: 0
3: 15
4: 216
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993096_914993111 9 Left 914993096 1:152515461-152515483 CCCGGCGCCCACCCCGGCGCCCG 0: 1
1: 0
2: 3
3: 76
4: 713
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400
914993101_914993111 -3 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993111 Original CRISPR CCTCCTGCTGCGGCTCCGGC AGG Exonic
900053279 1:610670-610692 CCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900151260 1:1180242-1180264 CCTCCTGGAGGGGCTCCTGCTGG + Exonic
900226483 1:1535673-1535695 CCTCATGCTGGGGCTGCTGCTGG - Exonic
900409631 1:2506858-2506880 GCTCCAGCTCCGGCTTCGGCGGG + Intergenic
900555679 1:3279244-3279266 CCTCCTGCTCCAGCTTCTGCAGG - Intronic
900573813 1:3373218-3373240 CCCCCTGCTGCAGTGCCGGCGGG + Intronic
901034363 1:6327386-6327408 CCTCCTCCTCCTGCTCCTGCCGG + Exonic
901067773 1:6502559-6502581 CCTCCGGCTGAGGCTACTGCGGG + Intronic
902169189 1:14597389-14597411 CCTCCTGCTGCGCCTTCAGGAGG - Intergenic
902298668 1:15485958-15485980 CCACCTGCTCCAGCTCTGGCTGG + Exonic
902333952 1:15744279-15744301 CCTGCTGCTGAGCCTCGGGCTGG + Exonic
902511087 1:16967471-16967493 CCTCCTGCAGCCCCTGCGGCTGG - Intronic
902637348 1:17743327-17743349 GCTCCTGCTCCTGCTCCTGCTGG + Intergenic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
903786358 1:25863791-25863813 CCTCCTGCCGAGTCTGCGGCAGG - Exonic
904882670 1:33712474-33712496 CCTGCTGCCGAGGCTCAGGCTGG - Intronic
909562982 1:77025782-77025804 CCTCCTGCTGCCCCTCCTCCAGG + Intronic
909578433 1:77203681-77203703 CCTTCTGCTGTGGCTTCAGCTGG - Intronic
909958248 1:81803015-81803037 CCTCTCACTGCGGCTCCGGGAGG - Intronic
910232404 1:84999307-84999329 CCTGCTGCTGCTGCTGCTGCTGG + Intronic
910426434 1:87123773-87123795 CCTTCTGCAGAGGCTCCAGCAGG - Intronic
911826788 1:102497418-102497440 TCTTCTGCTGCGGCTTCAGCCGG - Intergenic
912381451 1:109250014-109250036 GCTCCTCCTCCGGCTCCTGCCGG - Exonic
912993501 1:114511151-114511173 GCTCTTGCTGCGGCTGCGGCTGG - Exonic
913317624 1:117566032-117566054 CTCCCTGCTGGGGCTCAGGCAGG + Intergenic
914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG + Exonic
915074857 1:153299595-153299617 CCTCCTCCTGCTGCTCCCTCAGG + Intronic
915601276 1:156924497-156924519 CCTCCTGCTCCAGCTCCACCTGG - Exonic
916063460 1:161118032-161118054 CCGCCTGCTGGGTTTCCGGCCGG + Exonic
916735326 1:167602250-167602272 ACTCCTGCTGTGGTTCCGCCAGG + Intergenic
919712156 1:200739213-200739235 TCCGCTGCTGCGTCTCCGGCGGG + Intergenic
920225151 1:204433241-204433263 CCTCCTCCTGCCAATCCGGCAGG + Intronic
920431489 1:205921817-205921839 AGTCCTGCTGCAGCTCCTGCAGG + Exonic
920694353 1:208170513-208170535 CCTCATGCCCCGGCTCTGGCAGG - Intronic
920857600 1:209675631-209675653 TCTCCTGCTGCTCCTCCTGCAGG + Exonic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921764428 1:218953500-218953522 CCTCCTGCTGCTGCTGCTGCTGG - Intergenic
921945409 1:220882773-220882795 CCTCCTCCTGCTGCTTCTGCTGG + Intronic
922709382 1:227815767-227815789 CCTTCTGCTGCTGCTCCTGGTGG + Exonic
922802981 1:228372474-228372496 CCTCCTGCTGCTCCTCCGACTGG - Exonic
922832254 1:228609819-228609841 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922832814 1:228612060-228612082 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833375 1:228614301-228614323 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833935 1:228616542-228616564 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922834492 1:228618783-228618805 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835046 1:228620998-228621020 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835603 1:228623218-228623240 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836161 1:228625460-228625482 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836719 1:228627699-228627721 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837278 1:228629941-228629963 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837839 1:228632182-228632204 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838397 1:228634422-228634444 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838955 1:228636647-228636669 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922839515 1:228638888-228638910 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840076 1:228641119-228641141 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840636 1:228643360-228643382 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922841199 1:228645591-228645613 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
923008243 1:230068244-230068266 CCTCGTGCCGCCGCTCCGGACGG + Intronic
924728857 1:246693914-246693936 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
924853981 1:247857627-247857649 CCTCCTGCAGCGGCGCCGTGCGG - Exonic
1063352999 10:5373747-5373769 GCTCCTGCTGCTGCTCCTGGGGG + Exonic
1065140376 10:22714095-22714117 CCTCCGGCTGCAGCTGCTGCGGG - Intronic
1067654420 10:48180150-48180172 GCTCCTGCTGAGGCTTCGACTGG + Intronic
1068920525 10:62478518-62478540 CCTCCTGCTTCAGCTCAAGCAGG + Intronic
1069486593 10:68827674-68827696 CCGCCTTCTGCGCCTCCAGCCGG - Exonic
1069486680 10:68828010-68828032 CCGCCTTCTGCGCCTCCAGCCGG - Intronic
1071857870 10:89644681-89644703 GCTGCGGCTGCAGCTCCGGCAGG + Exonic
1072188475 10:93062875-93062897 CATCCTGCTGGGGTTGCGGCTGG + Exonic
1072377297 10:94830500-94830522 CGCCCTGCTTCGGCTCCCGCAGG + Intronic
1072731512 10:97850007-97850029 CCCGCTGCCGCGGCTCCTGCAGG - Intergenic
1074191997 10:111146192-111146214 CCTCCTGCTGCTGTTCAGGAAGG + Intergenic
1075866019 10:125719844-125719866 CCTCGAGCGGCGGCCCCGGCCGG - Exonic
1076569062 10:131420433-131420455 CCTCCTGCTGAGGCTCCCACCGG + Intergenic
1076730866 10:132438280-132438302 CCTCCTGCAGCAGGGCCGGCAGG + Intergenic
1076890119 10:133279231-133279253 CCTCCTGCTGCTGCTCCAACTGG - Exonic
1077259449 11:1608071-1608093 CCTCCAGCTGTGGCTCCTGTGGG - Exonic
1077413820 11:2415288-2415310 CCTCCTGCTTCCGCTGCAGCAGG + Exonic
1077494796 11:2881758-2881780 CCTCCTGCTGCAGCTGGGGCCGG - Intergenic
1079084265 11:17433925-17433947 CCTCCTGCACCGTTTCCGGCAGG + Intronic
1079116171 11:17641878-17641900 CTGCCTGCTGCGGCTCCTGCAGG + Exonic
1079882447 11:25944311-25944333 CCTCCTGGTGCAGCTGCAGCTGG - Intergenic
1083411550 11:62496763-62496785 CCTCCCTCTGCTGCTCAGGCTGG - Intronic
1083618013 11:64035933-64035955 ACTCCTCCCGCGGCTCCGCCGGG + Intronic
1083622526 11:64056217-64056239 CCACCTGCTGCAGCTCCTCCAGG - Intronic
1083679145 11:64343289-64343311 CCTGCTGCTGCGAACCCGGCTGG + Exonic
1083952861 11:65966445-65966467 CCTCCAGCTCCCGCTCCCGCAGG - Exonic
1084521536 11:69666199-69666221 CCACCTGCCGCTGCTCCCGCGGG + Exonic
1084956234 11:72693152-72693174 CCTCCTGCTGTGGCCCTGGACGG - Intronic
1085037574 11:73309232-73309254 GCTCCTGTTGCTGCTGCGGCCGG - Exonic
1085312755 11:75525913-75525935 GCTCGGGCTGCGGCTCCGGTGGG - Intergenic
1086888257 11:92226825-92226847 CCTCCCGCCGCGGCTGCTGCAGG - Intergenic
1087672938 11:101128280-101128302 CCTCCTGCTGCCGCCCCCGGCGG + Exonic
1088114211 11:106297582-106297604 CTTCCTGCAGTGGCTCAGGCTGG + Intergenic
1088696270 11:112368663-112368685 CCTCCTGCTGCTTCTGCCGCTGG + Intergenic
1088746075 11:112806101-112806123 CCACCTGCTGCAGCACCTGCTGG - Intergenic
1089270016 11:117295638-117295660 CCTGCTGCTGCTGCTGCTGCAGG + Intronic
1090274228 11:125408468-125408490 CCTCCTGGTGTGGCTCCTCCGGG - Intronic
1090423104 11:126589147-126589169 CTGCCTCCTGCGGCTCTGGCTGG + Intronic
1090699381 11:129279910-129279932 GCTGCTGCTGCGGCGGCGGCCGG - Intergenic
1090746080 11:129705737-129705759 CCTCCTGGTTCGGGTCCTGCAGG - Intergenic
1091645954 12:2272394-2272416 CCTCCTCCTGCTTCCCCGGCTGG + Intronic
1091974198 12:4811436-4811458 CCTCCTGCTCCGTCTCCCGGTGG - Exonic
1092462410 12:8698130-8698152 CCGCCGACTGCGGCTCCCGCAGG - Exonic
1095252864 12:39998999-39999021 TCCTCTGCTGCGGCTCCAGCTGG - Intronic
1096459834 12:51815972-51815994 TCTCCTGCTGCTGCCCAGGCTGG + Intergenic
1101734771 12:107454686-107454708 CCTCCTGCTGCTGCCCAGGAAGG - Intronic
1103400691 12:120641051-120641073 CCTCCTCTCGCGGCGCCGGCCGG - Exonic
1103561938 12:121797410-121797432 CCTCCTGCTGCTGTTCCTGCTGG - Intronic
1103971637 12:124676217-124676239 GCTCCGCCTGCGGCTCCGGATGG + Intergenic
1104010894 12:124929271-124929293 CTTCCTGCTGCCACTCTGGCTGG - Intergenic
1104729673 12:131097962-131097984 CCTCCTGCCTGGGCTCCTGCTGG + Intronic
1105070913 12:133234125-133234147 CCGCCTGCTGCTGCTCCTGCTGG + Exonic
1105244353 13:18635209-18635231 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
1105356357 13:19663467-19663489 CCTGCTGCTCCAGCTGCGGCCGG - Intronic
1105378380 13:19864291-19864313 CCTCCTGCTGCAGCCATGGCGGG - Intergenic
1105388834 13:19958057-19958079 CCTCCTGCTGCAGCCATGGCGGG + Intergenic
1105578840 13:21675327-21675349 CCCGCTGCTGCCGCTGCGGCAGG + Intronic
1105874250 13:24539568-24539590 CCTCCTGCAGCAGCCCCAGCTGG + Intergenic
1106526040 13:30542199-30542221 CCTCCTGCTCCAGCTCCTTCTGG + Intronic
1110408941 13:75183196-75183218 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1112431466 13:99354289-99354311 CCTCCTGCAGCGGCTCTGGCAGG + Intronic
1113418551 13:110151677-110151699 CCTCCTGCATTGGCTCCAGCGGG + Intronic
1114269570 14:21092543-21092565 GCTCCGGCTCCGGCTCCGGCTGG + Exonic
1115280263 14:31653895-31653917 TCCTCTGCTGCGGCTCCAGCTGG + Intronic
1115651164 14:35403978-35404000 CCTCCCCCCGCGGCCCCGGCGGG + Intronic
1116464382 14:45214530-45214552 CCCCCTGCTGAGGCCCCGGGCGG - Intronic
1118258449 14:64225394-64225416 CCTCCTGCTGCTGCTGCTCCTGG + Exonic
1120392476 14:83925737-83925759 CCTCATCCTGCTGCTCAGGCTGG + Intergenic
1121738352 14:96234415-96234437 GCTCCTGCTGGGGCTCCCACTGG + Intronic
1121776214 14:96592768-96592790 GTTCCTGCTCCGGCTCCTGCGGG + Intergenic
1122258801 14:100500256-100500278 TCTCCTGCTGCGGTTCTGGGTGG + Intronic
1122394050 14:101410165-101410187 TCTCCTGCTATGGCTCAGGCTGG - Intergenic
1122420753 14:101575633-101575655 CCTCCTGCCTGGGCTCCTGCTGG - Intergenic
1122504943 14:102226510-102226532 CCTGCTGCCGGGGCCCCGGCGGG - Intronic
1122551938 14:102555205-102555227 CTTTCTGCTGCGGCCCCGCCGGG - Intergenic
1123774577 15:23566002-23566024 CCTCCTCCTGAGGCTGGGGCAGG - Exonic
1125950343 15:43746412-43746434 CCTCCGGCTGCAGGTCCGCCTGG + Exonic
1126389024 15:48126034-48126056 CCTCTTGCTGGTGCTCTGGCAGG + Intronic
1126422531 15:48489978-48490000 ACGCCTGCTGCTGCTCCGTCGGG - Exonic
1128638470 15:69318162-69318184 GCCCCTGCTGCAGCTCAGGCTGG - Intronic
1129362160 15:75030639-75030661 CCTCCTGCTGGATCTCCTGCAGG + Intronic
1129488950 15:75904395-75904417 TCTCCTGCTGCTGCGCCAGCGGG + Intronic
1130061808 15:80575792-80575814 TCACCTGCTGCGGCACCTGCTGG + Intronic
1131131202 15:89901579-89901601 CCTCATGCTGTGGCTCAGGGAGG - Exonic
1131144013 15:90000351-90000373 CCTCCAGCTCCGGCGCAGGCCGG - Intergenic
1132599040 16:765759-765781 CCTCCGGCCGCGGTTCCGGCGGG + Exonic
1132643674 16:989175-989197 ACACCTGCTGGGGCTGCGGCTGG + Intergenic
1132747134 16:1441505-1441527 CCTCCTGCTGTGGCCTCAGCAGG - Intronic
1132769128 16:1551317-1551339 CCTCCTGCTGCTGATCCTTCGGG - Intronic
1132892369 16:2210584-2210606 GCTCCTGCTGCTGCTGCTGCTGG - Exonic
1133032959 16:3020433-3020455 CCTCGTGCTGGGGCTCTGGCTGG + Exonic
1133188291 16:4115821-4115843 CCTCCAGCTGCGGCTCCGGAGGG + Exonic
1133257903 16:4529278-4529300 CCTCCTGCTGGGTCTCCTGGCGG - Intronic
1133337829 16:5017645-5017667 AATCCTGCTGCGGCTTCTGCAGG - Exonic
1133847272 16:9466989-9467011 CCTGCTGCTGGGGCTGCGCCTGG - Intergenic
1133924436 16:10182042-10182064 CCTGCTGCAGAGCCTCCGGCTGG - Exonic
1135296502 16:21283809-21283831 CCTCCTGGTGTGCCTCTGGCGGG + Intronic
1136057542 16:27701625-27701647 GCTCCTCCTGCTGCCCCGGCCGG - Exonic
1136316609 16:29458163-29458185 CCACCTGCTGTGGGTCCAGCAGG + Exonic
1136431185 16:30197505-30197527 CCACCTGCTGTGGGTCCAGCAGG + Exonic
1136569176 16:31086652-31086674 CCTCCTGCTGGGCCACTGGCTGG - Exonic
1136580464 16:31148414-31148436 CCGCCTGCTGGGCCACCGGCTGG - Exonic
1136622063 16:31436057-31436079 CCTCCTGCTGAGCTGCCGGCTGG + Exonic
1137004267 16:35258368-35258390 CCTCCTGCTGTTCCTCCAGCTGG + Intergenic
1137981290 16:53072216-53072238 CCTCCAGCTGCTGCTCCTGCAGG + Intronic
1138507723 16:57486465-57486487 GCTCCGGCTGGGGCTCCGGCTGG + Exonic
1139509134 16:67416404-67416426 GCTCCGGCTCCGGCTCCAGCAGG + Exonic
1140302076 16:73767833-73767855 CTTCCTGCTGGGGCTCTGACTGG - Intergenic
1141429453 16:83963931-83963953 CCTCCTGCTGCTGCGTGGGCTGG + Intronic
1141752029 16:85964881-85964903 CTTCCTGCGGCGGCTCCAGGAGG - Intergenic
1141864598 16:86741421-86741443 CCTCTAGCAGCGGCTCCCGCAGG - Intergenic
1142200918 16:88760762-88760784 CCTCCTGCTGCGTCGAAGGCGGG - Intronic
1142351740 16:89583806-89583828 CCTGCTGCTGTGGCTCCGAGGGG + Intronic
1142377648 16:89714587-89714609 CCTCCTGCCCCTGCTCTGGCGGG - Intronic
1143109640 17:4545850-4545872 GGTCTTGGTGCGGCTCCGGCGGG + Exonic
1143140424 17:4739279-4739301 GCTCCTGCTTCTGCTCCTGCTGG - Exonic
1143345072 17:6243271-6243293 CCTGCTGCTGCAGCCCAGGCAGG + Intergenic
1143411553 17:6712549-6712571 CCTCCTGCTACAGCCCCAGCAGG + Intronic
1144676369 17:17164831-17164853 CCTCCAGCTGCTCCTCCAGCTGG - Intronic
1145057611 17:19713841-19713863 CATCCTGCTGCTCTTCCGGCAGG - Exonic
1145306600 17:21678945-21678967 GCTCCTGCTGCAGCCGCGGCGGG + Intergenic
1145884461 17:28372413-28372435 CCTGCTGTTGCGGCTGCTGCAGG + Exonic
1146721803 17:35129299-35129321 GCTCCTGCTGGGGCCCAGGCAGG - Intronic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1147267590 17:39244272-39244294 CCTCCTCCTGCTGCTCCTCCTGG + Intergenic
1147337863 17:39738112-39738134 ACTCCTGCTGGGGCTCCTCCAGG + Intronic
1148087645 17:45004087-45004109 CCTCATGCTGAGGCACCAGCAGG - Intergenic
1148443089 17:47721773-47721795 GCTACTGCTGAGGCTGCGGCAGG + Intergenic
1150445575 17:65225084-65225106 CCTCCTCCTGCCGCTCCCCCAGG + Exonic
1151165812 17:72202843-72202865 ACTCCTGCTGCTGCTGCTGCTGG + Intergenic
1151684803 17:75640169-75640191 CTTCCTGTTGGGGCTCCTGCCGG - Exonic
1152049123 17:77958887-77958909 CCTCCGCCTCCGGCTCGGGCGGG - Intergenic
1152060256 17:78067874-78067896 CCTCCTCCTGCAGCTCCTGGGGG + Exonic
1152068637 17:78124613-78124635 CCTCCTGCTGCTGCTGCTGGTGG - Exonic
1152570774 17:81120446-81120468 CCTCCTCCTCCTCCTCCGGCCGG + Exonic
1152588037 17:81197711-81197733 CCTCCTGCTGGGAGTCCAGCTGG + Exonic
1152735940 17:81996786-81996808 GCTCCTGCTCCTGCTCCTGCTGG - Exonic
1152823834 17:82450916-82450938 CCTCCTCCTGCGGCTCCGCCCGG - Intergenic
1152947465 17:83205778-83205800 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947499 17:83205914-83205936 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1153051189 18:904902-904924 GCTCCTCCTGCTGCTCCCGCTGG + Intergenic
1153746506 18:8185335-8185357 CCTCCTGGTGGGGCTCCTGGGGG - Intronic
1154170405 18:12046987-12047009 CCTCCTGCTCCTGCTCGAGCAGG - Intergenic
1154249734 18:12734461-12734483 CCTCATGCTGCTGCCCAGGCGGG - Intergenic
1155240140 18:23856918-23856940 CATCCTGCTGCTGCTGCTGCTGG + Intronic
1155759403 18:29547470-29547492 CCTTCTGCTGCGGCTCCTCTAGG - Intergenic
1156460344 18:37318190-37318212 CCTCCTTCTGCGGCCACTGCTGG + Intronic
1159815660 18:73071211-73071233 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1160534476 18:79584870-79584892 TCTTCTGCTGCTGCTCCTGCTGG + Intergenic
1160748917 19:724644-724666 CCTCATGCTGCTGCCCAGGCTGG + Intronic
1160975034 19:1789016-1789038 CTTCCTGCAGCGCCTCCTGCTGG - Exonic
1161384318 19:3982908-3982930 GCTCCAGCTGCAGCTCCAGCAGG + Exonic
1161428685 19:4218097-4218119 CCTCCAGCTGCCCCTCCAGCTGG - Exonic
1161477424 19:4494274-4494296 CCTCCTTCTCCTGCTCCCGCAGG - Exonic
1162345876 19:10117718-10117740 CCTCCTGCTTCCGTTCCTGCAGG + Intronic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1162738082 19:12757723-12757745 CTTCCTGCAGCGCCTCCTGCCGG + Exonic
1162740532 19:12771169-12771191 CCTCCTGCAACTGCTCCAGCTGG + Exonic
1163158909 19:15453337-15453359 GCCCCTGCGGCGGCCCCGGCCGG - Exonic
1164571397 19:29377135-29377157 CCTCCTGCTGGGTCTCTGCCAGG - Intergenic
1164722714 19:30444207-30444229 CAGCCTGCTGCAGCCCCGGCCGG + Exonic
1165120924 19:33557959-33557981 CCTGCGGTTGCGGCTCCGACAGG - Intergenic
1165242935 19:34481912-34481934 CTTCCCGCCGCCGCTCCGGCCGG - Exonic
1165319117 19:35075029-35075051 CCTGCTGCGGCAGCTCTGGCTGG - Intergenic
1165452129 19:35889901-35889923 TCACCTGCTGCGGCCCGGGCCGG - Exonic
1165595829 19:37010660-37010682 CCTCTTGCTGCGTCTCTGCCTGG + Intronic
1165990826 19:39812357-39812379 CCTGCTGCTTCGACTCCTGCTGG - Intergenic
1166091551 19:40512664-40512686 CCTGCTCCTGCAGCTCCGCCAGG - Exonic
1166146865 19:40844045-40844067 CCTCCAGCTGCGGCTCTCCCAGG + Intronic
1166151026 19:40875942-40875964 CCTCCAGCTGCGGCTCTCCCAGG + Intronic
1166155520 19:40908721-40908743 CCTCCAGCTGCGGCTCTCCCAGG + Intergenic
1166334184 19:42095596-42095618 CCTCTTCTTGCGTCTCCGGCCGG + Exonic
1166671900 19:44715264-44715286 CCTCCTTCTGCCCCTCCTGCTGG - Intergenic
1166732594 19:45067480-45067502 GCTGCGGCTGCGGCTCTGGCTGG - Exonic
1167049375 19:47069149-47069171 CCTCCTCCTGCTGCTTCTGCTGG + Exonic
1167050024 19:47072434-47072456 CCTGCTGCTGCAGCTGCTGCGGG + Exonic
1167155376 19:47735361-47735383 CCTCCTGCTGGGGCTCACCCTGG - Intronic
1167638307 19:50667567-50667589 CCTCCTGCTGCAGCTGGGGACGG - Exonic
1167659896 19:50790453-50790475 TCTCCTGCTGCTGCTGCTGCTGG + Exonic
1167671868 19:50858271-50858293 CCACCTGCTACGCCTCAGGCTGG + Exonic
1167674622 19:50876714-50876736 CCACCTGCTACGCCTCAGGCTGG + Exonic
1168666726 19:58210016-58210038 CCTCCTGCTTCTCCTCCTGCTGG - Exonic
924987788 2:287793-287815 CCTCCTCCTGGGGCTGCTGCTGG - Exonic
925024014 2:593852-593874 CCTCCTGCTCCTGCTCCTGTAGG - Intergenic
927147301 2:20174643-20174665 CCTCCTGATGTGGTTCCAGCTGG - Intergenic
927943251 2:27118842-27118864 CCACCTGCTGCGGCGCCGCGCGG + Exonic
929578478 2:43067626-43067648 GCTCCTGCAGCAGCTCCTGCTGG - Intergenic
929958815 2:46480662-46480684 CCTCGTGCTGCCGCTGCCGCTGG - Exonic
930300616 2:49611278-49611300 TCTTCTGCTGTGGCTCCAGCTGG - Intergenic
931671797 2:64654065-64654087 GCTCCTCCTGCGGCCGCGGCCGG - Intronic
935408754 2:102736872-102736894 CCTCCTGCTTCCGCTCGGGGCGG - Intronic
936373217 2:111920047-111920069 CCTAGTGCTGTGGCTCCAGCTGG + Intronic
937100368 2:119263871-119263893 CCTCCTGCTGCTGCCCCAGGTGG - Exonic
937195957 2:120156505-120156527 CCTCCTGCTGCAGCAGTGGCAGG - Intronic
937208730 2:120253329-120253351 CCTCCGGCCGCGGCTTGGGCAGG + Intronic
938007500 2:127799780-127799802 CCTCCTGCTGGAGTTCAGGCAGG + Intronic
938181700 2:129190360-129190382 GCTCCTGCTGCAGGTCGGGCTGG - Intergenic
945794115 2:214340579-214340601 GCACCTGCTGCTGCTCCAGCAGG + Intronic
946242912 2:218367799-218367821 CTTCCTGCTGCTGCGCCAGCCGG + Exonic
947156225 2:227164759-227164781 GCTCCTGCTGCCGCTCCTGCTGG + Exonic
948027369 2:234788984-234789006 CCTGATGCTGAGGCTGCGGCCGG + Intergenic
948109519 2:235443575-235443597 CCTCCTGCTAGGGCACAGGCTGG + Intergenic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
948902725 2:240964520-240964542 CCTCCTGCTGCAACGCCGCCTGG - Intronic
1168771887 20:420867-420889 CCTGCTGCTGCTGCTTCCGCTGG - Exonic
1168813192 20:719674-719696 CCTCCAGCTGCAGCTCCCCCAGG - Intergenic
1168813413 20:720839-720861 CCTCCAGCTGCAGCTCCTCCAGG - Intergenic
1169217506 20:3802067-3802089 CCTCCTGCTGCTCCTCAGGAGGG - Exonic
1170170990 20:13412303-13412325 CCTCCTCCTGCTGCTCTGCCAGG + Intronic
1170684177 20:18554057-18554079 CCTCCTGCTTCTCCTCCTGCCGG + Intronic
1171756325 20:29113357-29113379 CCTTCTGCTACGGCTCCATCTGG - Intergenic
1172457971 20:35092652-35092674 CATTCTGCTGCAGCTGCGGCAGG - Exonic
1172702886 20:36863564-36863586 GCTCCGGCTGCGGCTCCGCCCGG + Exonic
1172982185 20:38951743-38951765 CAACCTGCTGCGGATGCGGCTGG + Exonic
1173189497 20:40865267-40865289 CCTCCAGCTGCAGCTCCAGCTGG + Intergenic
1173552016 20:43938924-43938946 CCTCCTTGTGCAGCTCTGGCAGG + Intronic
1174918898 20:54681588-54681610 CCTCCTTCTGCGGCCACAGCTGG - Intergenic
1175247763 20:57591870-57591892 CCTGCTGCTGGGGCGCCGGGAGG + Intergenic
1175381755 20:58568600-58568622 CCTCCTGCAGCAGCACCAGCAGG - Intergenic
1175493596 20:59396114-59396136 CCTCCTCCTGCAGCTGCTGCTGG - Intergenic
1175847321 20:62065590-62065612 CCTGCGCCCGCGGCTCCGGCCGG + Exonic
1175892788 20:62322846-62322868 CCTCCTGCTGTGTCTCCTCCAGG + Intronic
1176030532 20:63009153-63009175 GCCCCTGCTGCGGCCCCTGCGGG + Intergenic
1176120585 20:63452890-63452912 CCTGCAGCTGGAGCTCCGGCTGG - Intronic
1176230997 20:64032834-64032856 CCTCCTCCTGCTGCTCCTGGGGG - Exonic
1176429027 21:6564825-6564847 CCTCCTTCTGCGGGGCCGTCCGG + Intergenic
1176451399 21:6865166-6865188 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1176879903 21:14179613-14179635 TCCTCTGCTGCGGCTCCAGCCGG - Intronic
1177894531 21:26844381-26844403 CCTCCTGCGGCGGAATCGGCAGG - Exonic
1178064113 21:28885103-28885125 CCGCCTGCTCCGGCTCAGGGCGG + Intronic
1178314764 21:31558872-31558894 TCTCCCGGGGCGGCTCCGGCCGG + Intronic
1178830646 21:36053880-36053902 CCTACTGCTGGGCCTCCTGCAGG + Intronic
1179704516 21:43173141-43173163 CCTCCTTCTGCGGGGCCGTCCGG + Intergenic
1180234515 21:46449741-46449763 CCCTCTGCCGCGGCTCCAGCCGG + Intergenic
1180705779 22:17808910-17808932 CCACCTGCTGCAGCTGCCGCTGG + Exonic
1181484237 22:23220391-23220413 CCTCCTGCTGCCTCTCTGCCTGG + Intronic
1181493947 22:23277511-23277533 CCTGCTGCTGCTGCTGCTGCTGG + Intronic
1181839828 22:25647203-25647225 GCTGCTGCTGCAGCTCCGGGTGG - Intronic
1183174139 22:36210295-36210317 TCCTCTGCTGCGGCTCCAGCCGG + Intergenic
1183282125 22:36937629-36937651 CCTCCTGTGGGGGCTCCGGCTGG - Exonic
1183601581 22:38843435-38843457 CCTCCTGCTGCAGCGCCGTCTGG + Exonic
1184160353 22:42693912-42693934 CCTCCTGCTGCGGCTGCTCCGGG - Exonic
1184209160 22:43025091-43025113 CCTCCTGCCGCTCCTCCAGCAGG + Intergenic
1184232716 22:43167361-43167383 CCTCCTGCTGAGGTCCTGGCAGG - Exonic
1185009430 22:48304992-48305014 CCCCCTGCTGCATCTCCGTCAGG - Intergenic
1185038011 22:48489753-48489775 CCCCCTCCTCCGGCCCCGGCAGG + Intronic
1185300506 22:50077469-50077491 CCTCATCCTGCTGCTCCTGCTGG - Exonic
1185372443 22:50467275-50467297 CCTCCTGCTGGGGCCCTGGTAGG - Intronic
949544621 3:5061800-5061822 CCTGCAGCTGGGGCTCCAGCTGG + Intergenic
949710238 3:6862860-6862882 CCTCCTGCTCCGGTGCCGGAGGG + Intronic
950264637 3:11564793-11564815 CCACCTGCTGCCGCTCCCCCGGG + Exonic
951543604 3:23806029-23806051 GCTGCTGCTGCGGCTGCGGCTGG - Exonic
951978556 3:28541476-28541498 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic
953810383 3:46107768-46107790 CCTCCTGCTGAGGTTGCTGCAGG + Intergenic
954069351 3:48131457-48131479 CCTGCTGCTGCGGCTGCTCCAGG + Intergenic
956425565 3:69130988-69131010 CCTCCTGCTGCTGCTACTACTGG + Intergenic
956780274 3:72597941-72597963 CCTGCTGCTGCTGCTACTGCTGG - Intergenic
956976968 3:74592027-74592049 TCTCCAGCTGCTGCTCTGGCTGG - Intergenic
957727468 3:84086698-84086720 CATCCTGCTTCAGCTCAGGCTGG + Intergenic
959960623 3:112294092-112294114 ACTCCTCCTGAGGCTCCGGATGG - Exonic
961370271 3:126424396-126424418 TCTCCTGCTGCCTCTCTGGCTGG - Intronic
962742685 3:138373538-138373560 CCTGATGCTGCGGCTACTGCTGG - Intronic
963043311 3:141084555-141084577 CCTCCAGCTGCTGCCCGGGCTGG - Intronic
963117022 3:141738676-141738698 GCTCCTGCTGCGGCTCCTGAGGG + Intronic
964358374 3:155870620-155870642 CCTCCTGCTTCCGCCCCGGCCGG - Exonic
966762303 3:183428754-183428776 CCTCCCGCTCCGGGTCCTGCCGG - Intronic
966860604 3:184229481-184229503 ACGCCTGCTGCTGCTGCGGCGGG - Intronic
966863340 3:184242564-184242586 CATCCTGCTGCAGCTCTGGCTGG - Exonic
967829803 3:193909293-193909315 CCTCCTGCCCCAGCTCCTGCAGG - Intergenic
968876325 4:3269647-3269669 CCTCCTGCTCCTCCTCCTGCAGG + Intronic
969436641 4:7192754-7192776 CCTGCTGCTGCTGCTGCTGCTGG + Exonic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
970448565 4:16144688-16144710 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
972541577 4:40043702-40043724 CCTCCTCCTCCTGCTCCTGCCGG + Intergenic
972830657 4:42810223-42810245 CCTCCTGCTGGGGTTCCAGAGGG + Intergenic
973799853 4:54466688-54466710 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
974039473 4:56845421-56845443 TCTCCTTCTGTGGCTCCGGCTGG - Intergenic
975096471 4:70462855-70462877 CCTCCTGCTGCAGTTCCTGCTGG - Intronic
975616396 4:76251755-76251777 CCGCAGGCGGCGGCTCCGGCCGG + Exonic
975985960 4:80202095-80202117 CCTCCTGCTGCTGCTGCTGCTGG - Exonic
976741869 4:88364971-88364993 TCTTCTGCTGTGGCTCCAGCGGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
979765543 4:124461320-124461342 TCTTCTGCTGCAGCTCCAGCCGG - Intergenic
982513709 4:156317844-156317866 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic
985080545 4:186260194-186260216 CATGCTGCTGCGGATCTGGCAGG + Intergenic
986178926 5:5375771-5375793 CCTCTTGCTGCAGCTCTGGCTGG - Intergenic
986506944 5:8461874-8461896 ACTGCTACTGCGGCTCTGGCAGG + Intergenic
990545347 5:56816033-56816055 TCTCCTGCAGCGGCCCCCGCCGG + Exonic
991565384 5:67999082-67999104 CTTCCTGCTGTGCCTCCAGCAGG - Intergenic
991963990 5:72072975-72072997 CTTCCTGCTGCTGCTCAGGGTGG - Intergenic
997978402 5:138453889-138453911 CCTCCCGCTGAGGTCCCGGCAGG - Intergenic
998406698 5:141878327-141878349 GCTCCGGCTCCGGCTCCGGCTGG + Exonic
998451133 5:142235553-142235575 CCCCCTTCTGCTGCTCCAGCTGG + Intergenic
1000237994 5:159380804-159380826 TCTTCTGCTTCGGCTCCAGCTGG + Intergenic
1000618819 5:163460064-163460086 CCGCCTGGTGCGGCCGCGGCCGG - Exonic
1001172266 5:169430718-169430740 TCTCATGCTGTGGCCCCGGCTGG - Intergenic
1001523578 5:172413128-172413150 CTTCCTGCTCCGGCTCCGCTGGG - Intronic
1001541451 5:172542708-172542730 CATCCTGCTGGCGCCCCGGCAGG + Intergenic
1001738024 5:174022953-174022975 CCTCCTGCTGTGCCTCCTTCAGG - Intergenic
1001746556 5:174096857-174096879 CCTCCTGCCACGGCTGAGGCTGG + Intronic
1001999430 5:176189418-176189440 CCTCCTCCTGCTGCTCCTCCAGG - Intergenic
1002140507 5:177134493-177134515 CCTGCAGCTGCGGATCCAGCAGG + Intronic
1002209886 5:177592286-177592308 CCTCCTGCTGGTGCTGTGGCTGG + Exonic
1002581650 5:180212523-180212545 CCTCCTGCTGGGGGTGCTGCTGG - Intergenic
1002649744 5:180682487-180682509 CCTCCTCCTGCTGCTCCTCCAGG + Intergenic
1002717033 5:181234244-181234266 CCTCCTGCCGCCGCTCTGCCAGG - Exonic
1003645561 6:7910731-7910753 CCTCCCGCTGCTGGCCCGGCCGG - Exonic
1005835003 6:29702331-29702353 GTTCCTGCTGCTGCTCCTGCAGG - Intergenic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006024465 6:31138365-31138387 CCTCCTCCTGGGGCTGGGGCTGG - Intronic
1006081926 6:31572799-31572821 CCTCCTTCTGGGGCTGCTGCTGG + Exonic
1007409387 6:41653217-41653239 CCTGCTGCTGCCGCTGCCGCAGG + Intronic
1007701963 6:43770964-43770986 CCTCCGGCTGCGGCTCCTCCCGG - Exonic
1008044911 6:46841918-46841940 TCTTCTGCTGCGGCTCCAGCTGG - Intergenic
1011608501 6:89127825-89127847 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1013500218 6:110742134-110742156 TCCTCTGCTGCGGCTCCAGCCGG - Intronic
1014336705 6:120146831-120146853 CCTCCTGCTCCTGCTCCTGCAGG + Intergenic
1014844442 6:126258245-126258267 CCTCCTCCTGCGGCCCTGGGGGG + Intergenic
1018960106 6:168441680-168441702 GGTCCTGCTGCGGCTGCGACGGG + Intronic
1019180490 6:170184540-170184562 GCCCCTCCTGTGGCTCCGGCGGG - Intergenic
1019246413 6:170712957-170712979 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019414713 7:921991-922013 CCTCCTGCTGCTGCTGCTTCTGG - Intronic
1019539956 7:1547009-1547031 ACCCCAGCGGCGGCTCCGGCGGG - Exonic
1019778960 7:2928672-2928694 GATGCTGCTGCGGCTCCGGGGGG + Exonic
1020462777 7:8443035-8443057 TCCCCCGCTGCCGCTCCGGCTGG + Intronic
1020727280 7:11831820-11831842 CCTGCTGCTGCTGCTACGCCCGG - Exonic
1022528624 7:31053420-31053442 GCTCCTGCGGCGGCTGCGGGGGG + Intronic
1024293524 7:47824741-47824763 CCTCCTGCAGCGAATCCTGCAGG + Intronic
1024317449 7:48035196-48035218 CCTCCTCATGCCGCTCTGGCTGG - Intergenic
1025850530 7:65239870-65239892 CGTCCCGCTCCGGCACCGGCGGG + Intergenic
1028985428 7:97005406-97005428 CCCCCGGCTGCAGCTCCGGCTGG + Intergenic
1029580470 7:101433738-101433760 CCTCCTGTTGCTGCTCTGACAGG - Intronic
1029708496 7:102287375-102287397 CCCCCTGCTAGGGCCCCGGCCGG + Intronic
1032267515 7:130379760-130379782 CCTGCTGCTGCTGCCCGGGCTGG + Intergenic
1034255473 7:149722491-149722513 CCTCCTGCTGGGGCTATGGGTGG - Exonic
1034426349 7:151016208-151016230 GCTCCTGCTGCTGCTGCTGCTGG + Exonic
1034447177 7:151119742-151119764 CCTCGTCCTGGGGCCCCGGCAGG - Intronic
1034447561 7:151121369-151121391 CCTGCTGCTGCTGCTGCTGCGGG + Intronic
1036664783 8:10731063-10731085 CCCCCAGCCCCGGCTCCGGCCGG - Intronic
1039936499 8:42051377-42051399 GCTCCGGCTTTGGCTCCGGCCGG - Intronic
1040727353 8:50398336-50398358 TCTCCTGCAGCGGCCCCTGCTGG + Intronic
1043426353 8:80152255-80152277 CCTCCTGCTGAGGATATGGCTGG - Intronic
1044514332 8:93120930-93120952 CCTCCAGCTGGAGCTGCGGCTGG - Intergenic
1045290186 8:100826256-100826278 CCTCCTGCTGGGGCTGGAGCTGG + Intergenic
1048368839 8:133759334-133759356 CCTCATTCTGAGGCTCCAGCTGG + Intergenic
1049103800 8:140598626-140598648 CCTCCTGGTGGGGCTCAGACAGG - Intronic
1049565258 8:143334828-143334850 GCGGCTGCTGCGGCTCCGGGCGG - Exonic
1051689690 9:19697276-19697298 CCTCCCGCTGCACCCCCGGCAGG - Intronic
1053173367 9:35906350-35906372 CCTGCTGCTGCTGCTGCTGCTGG + Exonic
1053314766 9:37041936-37041958 CCACCAGCTGCGGCTCTGGGGGG - Intergenic
1053372739 9:37576280-37576302 CCGGCTGCTGCGGCTCCAGCGGG - Intronic
1053474202 9:38370358-38370380 CTTCCTGCTGCCACCCCGGCTGG + Intergenic
1056712353 9:89001212-89001234 CCTCCCGCCGCGTCTCCAGCCGG + Exonic
1056763600 9:89431254-89431276 GCTCCTGCTCCTGCTCCTGCGGG + Intronic
1057653730 9:96936912-96936934 CCTCCTGCGGCGTCTCCTCCGGG + Intronic
1061089961 9:128420904-128420926 GCTCCAGCTGCTGCTCCTGCTGG + Exonic
1061140777 9:128764958-128764980 CCTTCTGCTGCTGCTGCTGCTGG - Intronic
1061802727 9:133121065-133121087 CCACACGCTGCGGCTCCGCCGGG + Exonic
1061883449 9:133579192-133579214 CCTCCTCCGGCGGCTCCTGCAGG + Exonic
1062192198 9:135253771-135253793 CCTCCTGCTGCCGTGCCGTCGGG + Intergenic
1062364468 9:136202307-136202329 CCCCATCCTGCGGCTCCAGCTGG + Intronic
1062397445 9:136358178-136358200 ACTGCTGCTGGGGCTCGGGCGGG - Exonic
1062453704 9:136626193-136626215 CCTCCTGCACCCGCTCCAGCTGG - Intergenic
1062486592 9:136779740-136779762 TCTTCTGCTGCGGCTCCAGCTGG + Intergenic
1062509150 9:136895274-136895296 CTTCCTGCTGCGGTTCTGCCTGG + Intronic
1062556643 9:137115861-137115883 CGTCCTGCGGGGGCCCCGGCAGG - Intergenic
1062582886 9:137236212-137236234 TGTCCTGCAGCGGCGCCGGCCGG + Exonic
1203517782 Un_GL000213v1:19351-19373 TCCTCTGCTGCGGCTCCAGCCGG + Intergenic
1186417590 X:9397357-9397379 CCTCCTTCTGCTGCCCAGGCTGG + Intergenic
1187904937 X:24056827-24056849 TCTCCTGCTGCTGCCCAGGCTGG - Intronic
1188185992 X:27115314-27115336 TCTTCTGCTGCGGCTTCAGCTGG - Intergenic
1190287220 X:48969749-48969771 CCTGCGGCAGCGGCTCTGGCGGG - Exonic
1192358627 X:70424995-70425017 CCCCCGGCTGCTGCTCCGTCTGG + Exonic
1192795514 X:74421778-74421800 GCTCCGGCTGGGGCTCGGGCGGG - Exonic
1194042221 X:88955822-88955844 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
1196856420 X:119989646-119989668 GCTCCTCCTGTGGCTTCGGCGGG - Intergenic
1200255457 X:154580141-154580163 CCTCCGGCTGCTGCTCTGGAGGG + Intergenic
1200262312 X:154624263-154624285 CCTCCGGCTGCTGCTCTGGAGGG - Intergenic
1201706594 Y:16944276-16944298 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic