ID: 914993112

View in Genome Browser
Species Human (GRCh38)
Location 1:152515494-152515516
Sequence CTCCTGCTGCGGCTCCGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 327}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993103_914993112 -9 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993097_914993112 9 Left 914993097 1:152515462-152515484 CCGGCGCCCACCCCGGCGCCCGC 0: 1
1: 0
2: 14
3: 153
4: 1145
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993098_914993112 3 Left 914993098 1:152515468-152515490 CCCACCCCGGCGCCCGCCTCCTC 0: 1
1: 0
2: 7
3: 61
4: 743
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993087_914993112 28 Left 914993087 1:152515443-152515465 CCCCGCTCCGTGTCCCGCCCCGG 0: 1
1: 0
2: 2
3: 35
4: 250
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993100_914993112 -1 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993099_914993112 2 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993095_914993112 11 Left 914993095 1:152515460-152515482 CCCCGGCGCCCACCCCGGCGCCC 0: 1
1: 2
2: 10
3: 103
4: 902
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993094_914993112 14 Left 914993094 1:152515457-152515479 CCGCCCCGGCGCCCACCCCGGCG 0: 1
1: 0
2: 15
3: 87
4: 671
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993089_914993112 27 Left 914993089 1:152515444-152515466 CCCGCTCCGTGTCCCGCCCCGGC 0: 1
1: 0
2: 3
3: 50
4: 409
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993093_914993112 15 Left 914993093 1:152515456-152515478 CCCGCCCCGGCGCCCACCCCGGC 0: 1
1: 1
2: 22
3: 295
4: 1580
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993101_914993112 -2 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993104_914993112 -10 Left 914993104 1:152515481-152515503 CCGCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993091_914993112 21 Left 914993091 1:152515450-152515472 CCGTGTCCCGCCCCGGCGCCCAC 0: 1
1: 0
2: 3
3: 37
4: 400
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993090_914993112 26 Left 914993090 1:152515445-152515467 CCGCTCCGTGTCCCGCCCCGGCG 0: 1
1: 1
2: 0
3: 15
4: 216
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993096_914993112 10 Left 914993096 1:152515461-152515483 CCCGGCGCCCACCCCGGCGCCCG 0: 1
1: 0
2: 3
3: 76
4: 713
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327
914993102_914993112 -3 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993112 Original CRISPR CTCCTGCTGCGGCTCCGGCA GGG Exonic
900555678 1:3279243-3279265 CTCCTGCTCCAGCTTCTGCAGGG - Intronic
902033516 1:13439658-13439680 CTCCACCTGCGGCCCCGGTAGGG + Intergenic
902637349 1:17743328-17743350 CTCCTGCTCCTGCTCCTGCTGGG + Intergenic
903397601 1:23013880-23013902 CACCTGCTGGGGCTCTGGGAGGG + Exonic
903542140 1:24102407-24102429 CAGCTGCTGTGGCTCTGGCATGG + Intronic
904263770 1:29306145-29306167 GTCCTGCTGCTGCTGCAGCAGGG - Intronic
904916479 1:33973988-33974010 CTTCTGCTGCAGCCCCTGCAAGG + Intronic
905214635 1:36398076-36398098 CTCCTTCCCAGGCTCCGGCATGG + Intergenic
905862651 1:41361536-41361558 CACCGGCTCGGGCTCCGGCATGG + Intergenic
906140381 1:43530915-43530937 CTCCAGCTTCGGCTCCGGCTCGG + Exonic
906140393 1:43530957-43530979 CTCCGGCTCCGGCTCCAGCTCGG + Exonic
906223648 1:44103429-44103451 CTCCAGCTTTGGCTCTGGCATGG - Intergenic
906296197 1:44650482-44650504 CTCCTGCTGCGGGGCTGGCCAGG + Intronic
906640472 1:47438075-47438097 CTCCGGCAGCGGCTCGGGCTCGG - Exonic
907631735 1:56089797-56089819 CGCCTGCTTCGGCTCGCGCACGG - Intergenic
911066766 1:93796501-93796523 CCCCTGCTTCGGCTCGCGCACGG + Intronic
911219752 1:95234229-95234251 CTCCTGCACAGGCTCCGCCATGG - Exonic
911988833 1:104664691-104664713 GTCCTGCTTCGGCTCGCGCACGG + Intergenic
912431535 1:109630675-109630697 CTCCATCAGCGGCTCCTGCACGG - Exonic
912467753 1:109885803-109885825 GTCCTGCTGTGGCTCCTGCGTGG - Intergenic
912993500 1:114511150-114511172 CTCTTGCTGCGGCTGCGGCTGGG - Exonic
913299791 1:117358544-117358566 CTCCTGCTTCGGCTGGCGCACGG + Intergenic
913610964 1:120509516-120509538 CTCCTGCTGAGACTCAGCCAAGG + Intergenic
913983850 1:143547472-143547494 CTCCTGCTGAGCCTCAGCCAAGG - Intergenic
914330935 1:146670538-146670560 CTCCTGCTGGGGATTCTGCATGG - Intergenic
914447562 1:147762663-147762685 TTCCTGCTGACGCTCAGGCAAGG + Intronic
914580225 1:149012723-149012745 CTCCTGCTGAGCCTCAGCCAAGG - Exonic
914846481 1:151286582-151286604 CTCCTGCTGAGCCTCCAGCCAGG - Exonic
914993112 1:152515494-152515516 CTCCTGCTGCGGCTCCGGCAGGG + Exonic
915120940 1:153629216-153629238 CTCCAGCTGCCCCTCTGGCATGG + Intronic
916660693 1:166920576-166920598 CCCCTGCGGCCTCTCCGGCAAGG + Intronic
919493444 1:198234732-198234754 CTCCTGCTGCTGCTCCTGTGTGG + Intronic
920147262 1:203872696-203872718 CTCCAGCTTTGGCTCTGGCAGGG - Intergenic
920431490 1:205921818-205921840 GTCCTGCTGCAGCTCCTGCAGGG + Exonic
922481182 1:225940932-225940954 GTCCTGCTGCGGCGCAGCCACGG - Exonic
922802980 1:228372473-228372495 CTCCTGCTGCTCCTCCGACTGGG - Exonic
922832256 1:228609820-228609842 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922832816 1:228612061-228612083 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922833377 1:228614302-228614324 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922833937 1:228616543-228616565 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922834494 1:228618784-228618806 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922835048 1:228620999-228621021 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922835605 1:228623219-228623241 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922836163 1:228625461-228625483 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922836721 1:228627700-228627722 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922837280 1:228629942-228629964 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922837841 1:228632183-228632205 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922838399 1:228634423-228634445 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922838957 1:228636648-228636670 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922839517 1:228638889-228638911 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922840078 1:228641120-228641142 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922840638 1:228643361-228643383 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
922841201 1:228645592-228645614 CCCCGGCTGCGGCTGCGGCGGGG + Intergenic
923000395 1:230002278-230002300 CTCCTCCTGCTGCACCTGCAGGG - Intergenic
923369385 1:233295444-233295466 GTGCTGCAGCTGCTCCGGCAGGG - Exonic
923800716 1:237205821-237205843 CTCCTGCTGAGGCCCCATCACGG - Intronic
924052310 1:240091876-240091898 CTGCGGCTGCGGCTGCGGCTAGG - Exonic
924583893 1:245345230-245345252 CTCCAGCTGCGGGTAGGGCAGGG - Intronic
1063353000 10:5373748-5373770 CTCCTGCTGCTGCTCCTGGGGGG + Exonic
1063958745 10:11288575-11288597 CTCCTGCTGCATCACCTGCAAGG - Intronic
1064181602 10:13121182-13121204 CTCCTGCTGTGGCTAAGGGAAGG + Intronic
1065605583 10:27414206-27414228 CTTCTGCTCCGGCCCCGGCCTGG + Exonic
1066785198 10:38995578-38995600 CTCCTGCTTCGGCTCATGCTCGG + Intergenic
1067472943 10:46549371-46549393 CTGCTGCGGCTGCTCCGGCGCGG - Exonic
1067654421 10:48180151-48180173 CTCCTGCTGAGGCTTCGACTGGG + Intronic
1072377298 10:94830501-94830523 GCCCTGCTTCGGCTCCCGCAGGG + Intronic
1074191998 10:111146193-111146215 CTCCTGCTGCTGTTCAGGAAGGG + Intergenic
1075922497 10:126224855-126224877 CTCCTGCTGCAGCACCTGCCTGG - Intronic
1076140871 10:128077729-128077751 CTGCTGCTGCTGCTTCTGCACGG - Exonic
1076730183 10:132434627-132434649 CTCCTGCTGCGGCTCATGTTTGG - Intergenic
1077171505 11:1168358-1168380 CTGCAGCTGCGGCTCCTACAAGG - Intronic
1078050468 11:7961168-7961190 CTCCAGCTCCTGCTCCGGGAAGG + Exonic
1078067923 11:8090073-8090095 CTTCTGCTTCTGCTCCAGCAGGG - Exonic
1082007264 11:47426308-47426330 CTCCCGTTGCGGCTCCCGCCTGG - Exonic
1082623861 11:55460074-55460096 GCCCTGCTTCGGCTCCCGCACGG - Intergenic
1083186297 11:61019754-61019776 CTCCTGCAGCAGCACTGGCATGG - Exonic
1083622525 11:64056216-64056238 CACCTGCTGCAGCTCCTCCAGGG - Intronic
1084732099 11:71080256-71080278 CTCCTGCTGAGGCCTGGGCAGGG + Intronic
1084949948 11:72659322-72659344 CTCCTGCTGCAGCTCTGACTCGG + Intronic
1085312754 11:75525912-75525934 CTCGGGCTGCGGCTCCGGTGGGG - Intergenic
1089270017 11:117295639-117295661 CTGCTGCTGCTGCTGCTGCAGGG + Intronic
1090205322 11:124880540-124880562 CTCCGACTCCGGCTCCGGCCAGG - Exonic
1091750908 12:3020742-3020764 GTCCTGCTGCTGCTCCAGGAAGG - Exonic
1092605384 12:10112466-10112488 CTCCTGCTGCTGCTTCAGTATGG - Intergenic
1094451598 12:30588514-30588536 ATCCTGCTTCGGCTCACGCACGG - Intergenic
1094486939 12:30933066-30933088 GTCATCCTGCGGCTCTGGCAGGG - Intronic
1094817719 12:34204087-34204109 CTCCTGGTGGGGCTGCAGCAAGG - Intergenic
1095958507 12:47819656-47819678 CTCCGGCTCCGGCTCCGGCTCGG - Intronic
1098498683 12:71166149-71166171 CTCCACCTGCGGCTCCGGTGTGG - Intronic
1099732782 12:86526318-86526340 CTCCTGCTGCAGCAGTGGCAGGG + Intronic
1099973802 12:89525791-89525813 CTCCAGGTGCGGCTTCGGCCCGG + Intronic
1102196449 12:111028861-111028883 CTCCTGCTTCAGGTCCGGGATGG - Intergenic
1102893742 12:116581963-116581985 CTCCTACAGCTGCTCTGGCAGGG - Intergenic
1104641768 12:130471718-130471740 CTCCTGCTGCTCCTGCTGCAGGG + Intronic
1105871079 13:24506768-24506790 CTCCACCTGCGGCCCTGGCATGG - Intronic
1107155021 13:37155803-37155825 CCCCTGCTTCGGCTCACGCACGG + Intergenic
1107162701 13:37250505-37250527 CCCCTGCTTCGGCTCGCGCACGG - Intergenic
1108478482 13:50843566-50843588 CTCCTGCTGCAGCAGCTGCAAGG + Exonic
1108947969 13:56046294-56046316 CTACTGCTTCGGAACCGGCAGGG - Intergenic
1110912064 13:80977509-80977531 CTCCAGCTGTGGCTCACGCAGGG - Intergenic
1112525971 13:100147402-100147424 CTGCTGCTGGGGCTCTGGTAGGG + Intronic
1112622372 13:101065512-101065534 TTCCTGCTGCGGCTACTGCGTGG - Exonic
1114258759 14:21023295-21023317 CACCTCCTGCAGCTCCGCCATGG + Exonic
1114269571 14:21092544-21092566 CTCCGGCTCCGGCTCCGGCTGGG + Exonic
1114801182 14:25777285-25777307 GCCCTGCTTCGGCTCCTGCATGG + Intergenic
1115279024 14:31640055-31640077 GCCCTGCTTCGGCTCCGGCACGG + Intronic
1116286147 14:42973375-42973397 GCCCTGCTTCGGCTCAGGCACGG + Intergenic
1116736914 14:48702700-48702722 ATCCTGCTTCGGCTCATGCACGG + Intergenic
1117963937 14:61188426-61188448 CTCCGGCTCCGGCTCCGGGTCGG + Intronic
1121310111 14:92931352-92931374 CTCCTGCATGGGCTCCGGGAGGG - Exonic
1121776215 14:96592769-96592791 TTCCTGCTCCGGCTCCTGCGGGG + Intergenic
1121997276 14:98612985-98613007 CTCCTGCTGAGGCGCAGGCTCGG + Intergenic
1122136094 14:99633726-99633748 CTCCTGCTCCAGCCCCAGCAAGG - Intergenic
1122329410 14:100902600-100902622 CTGCTGCTGCTGCTACTGCAGGG - Intergenic
1122394049 14:101410164-101410186 CTCCTGCTATGGCTCAGGCTGGG - Intergenic
1122486619 14:102086647-102086669 CGCGGGCTGCGGCTCCGCCACGG + Intronic
1122668821 14:103354325-103354347 CTCCTGCTCCCGCTCCTGCCTGG + Intergenic
1122789898 14:104179759-104179781 CACCTCCTGCGGCCCCGGGATGG - Exonic
1122862564 14:104589111-104589133 CTCCTGCTGCTGCTAGGGCCTGG + Exonic
1123011010 14:105349494-105349516 CACCTGCTGTGGCTCTGACACGG + Intronic
1125840981 15:42801073-42801095 CTCCAGCTTTGGCTCTGGCATGG - Intronic
1126348081 15:47717511-47717533 CTGCTGCTGCTGCTGCTGCAAGG + Intronic
1126389025 15:48126035-48126057 CTCTTGCTGGTGCTCTGGCAGGG + Intronic
1126422530 15:48489977-48489999 CGCCTGCTGCTGCTCCGTCGGGG - Exonic
1127117546 15:55743045-55743067 CTCCGGCTCCGGCACCGGCGTGG + Intronic
1128290859 15:66477287-66477309 CTACAGCTGCTGCTCAGGCATGG - Intronic
1128548497 15:68583107-68583129 CTCCTGCCTCAGCTCCAGCAGGG + Intronic
1129203739 15:74022950-74022972 CTCCTGCAGCGCCTGCGTCATGG - Exonic
1130061809 15:80575793-80575815 CACCTGCTGCGGCACCTGCTGGG + Intronic
1131131201 15:89901578-89901600 CTCATGCTGTGGCTCAGGGAGGG - Exonic
1131300233 15:91193203-91193225 CTCCTCCTGCGGCACTTGCAGGG - Intronic
1132610418 16:813335-813357 CTATTGCTGCGGGACCGGCAAGG + Exonic
1132639344 16:970646-970668 TTCCTGCTGGGGCCCGGGCAAGG - Intronic
1132642638 16:984737-984759 CGCCTGCTGCAGCTCCGTCTTGG - Exonic
1132642643 16:984764-984786 CTCCAGCTTCAGCTCCGGCTTGG - Exonic
1132668193 16:1091315-1091337 CTCCTGATGCTGCTCCTGCCCGG + Intronic
1132747133 16:1441504-1441526 CTCCTGCTGTGGCCTCAGCAGGG - Intronic
1132897942 16:2237727-2237749 CTCCTGCGGCGGCTCAGACACGG + Intronic
1133244952 16:4442399-4442421 CTACTGTGGCGGCTCCGGCATGG + Exonic
1133337828 16:5017644-5017666 ATCCTGCTGCGGCTTCTGCAGGG - Exonic
1134055912 16:11169798-11169820 CTCCTGCTGTAGCCACGGCAGGG + Intronic
1134362100 16:13541127-13541149 CTCCTGCTTCTGCTCCAGCCAGG - Intergenic
1136019343 16:27430099-27430121 CTCCTGCTGCTGCTCCAGGGAGG + Exonic
1136684985 16:31988772-31988794 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136785599 16:32932307-32932329 GTCCTGCTGCAGCTGGGGCATGG + Intergenic
1136884172 16:33921497-33921519 GTCCTGCTGCAGCTGGGGCATGG - Intergenic
1136996792 16:35196091-35196113 CTGCTGGTGCCGCTCGGGCAGGG - Intergenic
1137709099 16:50554224-50554246 CACCTGCTGTGGGTCCTGCAAGG + Intronic
1138507724 16:57486466-57486488 CTCCGGCTGGGGCTCCGGCTGGG + Exonic
1139438161 16:66948732-66948754 CTCCTGCTGCTTCTCCTCCAGGG + Intergenic
1140002618 16:71040366-71040388 CTCCTGCTGGGGATTCTGCATGG + Intronic
1141752028 16:85964880-85964902 TTCCTGCGGCGGCTCCAGGAGGG - Intergenic
1141864597 16:86741420-86741442 CTCTAGCAGCGGCTCCCGCAGGG - Intergenic
1142112189 16:88338857-88338879 CTCCTCCTGAGGCTCCAGGAGGG - Intergenic
1142303935 16:89275153-89275175 CTCCTTCAGGGGCTCCGCCAGGG + Exonic
1142626768 17:1197247-1197269 CTCCTGCTGTGGCGCAGGGAGGG + Intronic
1143109641 17:4545851-4545873 GTCTTGGTGCGGCTCCGGCGGGG + Exonic
1143345073 17:6243272-6243294 CTGCTGCTGCAGCCCAGGCAGGG + Intergenic
1145208760 17:20997966-20997988 TGCCTGCTGTGGCTGCGGCAGGG - Intergenic
1145306601 17:21678946-21678968 CTCCTGCTGCAGCCGCGGCGGGG + Intergenic
1147145926 17:38484453-38484475 GTCCTGCTGCAGCTGAGGCATGG + Intronic
1147200790 17:38799798-38799820 CTCCCCTTCCGGCTCCGGCACGG - Exonic
1147382238 17:40062851-40062873 CTCCGGCTGGGGCTCGGGCTCGG - Exonic
1148379971 17:47189213-47189235 CCCCTGTAGCGGCTCCGGCCCGG + Intronic
1148443090 17:47721774-47721796 CTACTGCTGAGGCTGCGGCAGGG + Intergenic
1148752110 17:49951396-49951418 CTCCAGATGCGGCCCCTGCAAGG + Intergenic
1150818402 17:68413960-68413982 GTCCTGCTTCGGCTCGCGCACGG + Intronic
1152735939 17:81996785-81996807 CTCCTGCTCCTGCTCCTGCTGGG - Exonic
1153474949 18:5489067-5489089 CTCCTTGGGCGGCTCCGGCACGG + Exonic
1154170404 18:12046986-12047008 CTCCTGCTCCTGCTCGAGCAGGG - Intergenic
1157300633 18:46476616-46476638 CTCCTGCTGCCTCTCCATCAAGG + Intergenic
1157641132 18:49215921-49215943 GCCCTGCTTCGGCTCCCGCACGG - Intronic
1158663376 18:59409790-59409812 CCCCTGCTTCGGCTCGCGCACGG + Intergenic
1161099785 19:2415911-2415933 ATCCTGCTGGGGCTGCTGCATGG + Intronic
1161235653 19:3196793-3196815 CTGCTGCTGCAGCACTGGCAGGG + Intronic
1161298633 19:3532294-3532316 CTCCTCCTGCTGCTCCCTCAAGG - Intronic
1161346580 19:3771439-3771461 CTTCTGCTGTTGCTCCGGGAGGG + Intronic
1161376745 19:3943146-3943168 CTCCTGCTTCCCCTCCAGCACGG - Intergenic
1161384319 19:3982909-3982931 CTCCAGCTGCAGCTCCAGCAGGG + Exonic
1161466406 19:4433078-4433100 CAGCTGCTGCCGCTCCTGCACGG + Exonic
1162351170 19:10150545-10150567 CTCCTGCAGGGGCTCAGCCACGG + Intronic
1163158756 19:15452702-15452724 CTGCTCCTGCTGCTCCGTCAAGG + Exonic
1165058708 19:33194685-33194707 CTCTGGCTGCGGCTCGGGCTCGG - Exonic
1165452128 19:35889900-35889922 CACCTGCTGCGGCCCGGGCCGGG - Exonic
1166055127 19:40284040-40284062 CTCCTGCTGCTTCTCTGGGAAGG + Intronic
1166146866 19:40844046-40844068 CTCCAGCTGCGGCTCTCCCAGGG + Intronic
1166151027 19:40875943-40875965 CTCCAGCTGCGGCTCTCCCAGGG + Intronic
1166155521 19:40908722-40908744 CTCCAGCTGCGGCTCTCCCAGGG + Intergenic
1166694791 19:44846410-44846432 CTCCGGCTCCGGCTCCGGGCCGG - Intronic
1166732593 19:45067479-45067501 CTGCGGCTGCGGCTCTGGCTGGG - Exonic
1166792209 19:45405032-45405054 CTCCAGCTCGGGCTCCGGCTTGG + Intronic
1166861595 19:45814800-45814822 ATGCTGCAGCGGCTCCAGCAGGG - Exonic
1168301452 19:55407423-55407445 CTCCTGCTCCGCCTGCGGGAAGG + Intronic
925024013 2:593851-593873 CTCCTGCTCCTGCTCCTGTAGGG - Intergenic
925321503 2:2973660-2973682 CTCCTCCTGTGGCTCCTCCAAGG - Intergenic
925561716 2:5203365-5203387 CTGCAGCTGCCGCTCCTGCATGG - Intergenic
927651892 2:24918343-24918365 CTCCTGCTGCTGCTGGGCCACGG + Exonic
928290616 2:30034192-30034214 CTCCTTCTCTGGCTCCAGCAAGG + Intergenic
929382023 2:41364933-41364955 CTCCTGCTGCAGCAGTGGCAGGG - Intergenic
931465026 2:62478220-62478242 TTCATGCTGTGGCTCCGTCAAGG - Intergenic
932833206 2:75010551-75010573 CTCGTGCTGCTGTCCCGGCAGGG + Intergenic
933558464 2:83861704-83861726 CTCCTGCTGCTTCTGCTGCAGGG - Intergenic
936661343 2:114547311-114547333 CTGCTGCTGCTGCCCCTGCAGGG + Intronic
937195956 2:120156504-120156526 CTCCTGCTGCAGCAGTGGCAGGG - Intronic
937208731 2:120253330-120253352 CTCCGGCCGCGGCTTGGGCAGGG + Intronic
944763397 2:202840441-202840463 CTCCAGCTTTGGCTCTGGCATGG - Intronic
945988165 2:216371441-216371463 CTCCTCCTCCGGCTCCGGGTCGG + Exonic
947749320 2:232524435-232524457 CTTCTACTGCAGCTCCGGAAAGG + Intronic
948614488 2:239189956-239189978 CTGCAGCTGCTGCTCCCGCAGGG + Exonic
1169111294 20:3035887-3035909 CTGCTGCTGCTGCTTCTGCACGG - Exonic
1170170991 20:13412304-13412326 CTCCTCCTGCTGCTCTGCCAGGG + Intronic
1170781325 20:19428143-19428165 CTCATGCTGCTGCTACTGCATGG - Intronic
1172101280 20:32484791-32484813 CTCCTCCTGCGCCCCGGGCAAGG - Intronic
1172457970 20:35092651-35092673 ATTCTGCTGCAGCTGCGGCAGGG - Exonic
1172752010 20:37257789-37257811 CTCCTACTTCGGCTCCTGGAAGG + Intronic
1175247764 20:57591871-57591893 CTGCTGCTGGGGCGCCGGGAGGG + Intergenic
1175381754 20:58568599-58568621 CTCCTGCAGCAGCACCAGCAGGG - Intergenic
1175997175 20:62817092-62817114 CTCCTGCTCCTGCTCCTGCTCGG + Exonic
1177894530 21:26844380-26844402 CTCCTGCGGCGGAATCGGCAGGG - Exonic
1179999295 21:44987804-44987826 CGCCTGCAGCGGCTCCGGCCTGG - Intergenic
1180559007 22:16601253-16601275 CTCCGGCTCCGGCTCCGGCTCGG - Intergenic
1180871629 22:19150061-19150083 CTGCTGCTGCGGCCCCCGCGCGG - Exonic
1182485368 22:30635775-30635797 CTCCTGCTGCGACTCACGCCCGG - Exonic
1184035276 22:41915083-41915105 CTCCGGCTCCGGCTCCCGCTCGG + Intergenic
1184160352 22:42693911-42693933 CTCCTGCTGCGGCTGCTCCGGGG - Exonic
1184313390 22:43663833-43663855 AGCATGCTGGGGCTCCGGCAAGG - Intronic
1184620417 22:45672230-45672252 CTCCCGCGGCGGCCCCGGCCTGG + Intronic
1184660954 22:45965294-45965316 CTCCTGCTGTGGGTCCCACAGGG + Intronic
1184871261 22:47239954-47239976 CACCTGCAGCGGCTGGGGCAGGG - Intergenic
1185009428 22:48304991-48305013 CCCCTGCTGCATCTCCGTCAGGG - Intergenic
950411519 3:12841055-12841077 CTGCTGCTGCGGGACCGCCAAGG - Intronic
950548963 3:13655122-13655144 CTCCTGCTGCAGCGCCGTCCTGG - Intergenic
950601302 3:14037617-14037639 CTCCACCCGCGGCCCCGGCACGG + Intronic
951543603 3:23806028-23806050 CTGCTGCTGCGGCTGCGGCTGGG - Exonic
953670620 3:44959071-44959093 CTCCTCCTCTGGCTCTGGCATGG - Intronic
953928669 3:46995338-46995360 CACCTGCTGCGCCCCCGGCCAGG + Exonic
954931325 3:54285104-54285126 GTCCTGCTTCGGCTCGCGCACGG - Intronic
955997063 3:64688182-64688204 CTCCGGCTGCGAGTCCCGCACGG - Intergenic
956978991 3:74614682-74614704 CTCCGGCTCCGGCTCCGACGCGG + Intergenic
957127446 3:76180006-76180028 TTGCTTCTGCTGCTCCGGCAGGG + Intronic
957905897 3:86554291-86554313 CTCCTACTGCTACTCCGCCAAGG - Intergenic
957966225 3:87324591-87324613 CTCCAGCTTTGGCTCTGGCATGG + Intergenic
958496064 3:94846186-94846208 GCCCTGCTTCGGCTCAGGCACGG - Intergenic
959891575 3:111562054-111562076 GCCCTGCTTCGGCTCCCGCACGG + Intronic
963140998 3:141946003-141946025 CTCATGCTGGGGCTCGGGAAAGG + Intergenic
965997290 3:174899517-174899539 CTCTTGCTTCTGCTCTGGCAAGG + Intronic
966860603 3:184229480-184229502 CGCCTGCTGCTGCTGCGGCGGGG - Intronic
966863339 3:184242563-184242585 ATCCTGCTGCAGCTCTGGCTGGG - Exonic
967829802 3:193909292-193909314 CTCCTGCCCCAGCTCCTGCAGGG - Intergenic
968653877 4:1770460-1770482 CTCCCCCTGCGGCCCGGGCACGG + Intergenic
969317677 4:6391729-6391751 CCCCTGCTGCCGCTCCCCCAAGG - Intronic
969691663 4:8707282-8707304 CTCATCCTGCGGCTCGGGCAAGG - Intergenic
970033131 4:11700474-11700496 TTCCTGCTGCTGCTGCTGCATGG - Intergenic
970202891 4:13627516-13627538 CTGCGGCTGCGGCTGCGGCGGGG + Exonic
973144196 4:46804778-46804800 CTCCACCTGCGGCCCCGGTAGGG - Intronic
973311147 4:48711234-48711256 ATCCTGCTTCGGCTCGCGCACGG - Intronic
973322833 4:48827794-48827816 CTCCACCTGCAGCCCCGGCATGG + Intronic
975096470 4:70462854-70462876 CTCCTGCTGCAGTTCCTGCTGGG - Intronic
977164294 4:93676948-93676970 GTCCTGCTTCGGCTCGTGCATGG - Intronic
977294233 4:95193374-95193396 CTCCTGTGCCGGCTCCAGCACGG - Intronic
979328638 4:119405258-119405280 CTCCTGCTGGGGCTACAGGATGG + Intergenic
979547181 4:121951615-121951637 CTCCTCCTCCGGCGCCGGGAAGG + Exonic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
979865253 4:125745257-125745279 CTGCTGGAGGGGCTCCGGCATGG - Intergenic
979920502 4:126490294-126490316 CGCCTGCCCCTGCTCCGGCATGG + Intergenic
980018120 4:127676769-127676791 TCCCTGCTTCGGCTCAGGCATGG - Intronic
982765771 4:159346876-159346898 CTGCTGCTGGGGCTGTGGCAGGG - Exonic
985897367 5:2756597-2756619 CGCCAGCTGCGGCTCCAGCCTGG + Intergenic
986178925 5:5375770-5375792 CTCTTGCTGCAGCTCTGGCTGGG - Intergenic
988035505 5:25823265-25823287 CTCCTCCTGCAGCCCTGGCATGG - Intergenic
990545348 5:56816034-56816056 CTCCTGCAGCGGCCCCCGCCGGG + Exonic
991383988 5:66063506-66063528 ACCCTGCTTCGGCTCAGGCATGG + Intronic
991565383 5:67999081-67999103 TTCCTGCTGTGCCTCCAGCAGGG - Intergenic
992680923 5:79152338-79152360 CCCCTTCTGCGGCCCCGGGAGGG + Intronic
993624489 5:90208493-90208515 GCCCTGCTTCGGCTCCGGCACGG - Intergenic
993663637 5:90668456-90668478 ACCCTGCTTCGGCTCCCGCATGG + Intronic
993900953 5:93584216-93584238 CTCCTGCTCGGACTCCGGCCCGG + Exonic
994647692 5:102491339-102491361 CTCCACCTGCGGCCCCGGTAGGG - Intronic
995361423 5:111302391-111302413 GCCCTGCTTCGGCTCCCGCACGG - Intronic
996954230 5:129164204-129164226 CTCCTGCTGCAGCAGTGGCAGGG + Intergenic
997228717 5:132228027-132228049 CTCCGGCTCCGGCTCCCGCGAGG - Intronic
997239271 5:132294815-132294837 GTCCCGCTGCGGCTGCGGGACGG + Exonic
998256778 5:140594350-140594372 CTCCTGCTCTGCCTCCTGCAGGG + Intergenic
998847007 5:146320353-146320375 CTGCTGCTGAGGCTGCGGCAAGG + Intronic
1001172265 5:169430717-169430739 CTCATGCTGTGGCCCCGGCTGGG - Intergenic
1002136318 5:177110050-177110072 CTCCGGCTCCGGCTCCGGGAAGG + Intergenic
1004615079 6:17281534-17281556 CTCCGGCTGCGGCTGCGGCTCGG - Exonic
1006388062 6:33743035-33743057 CTGCTGCTGCAGCACTGGCAAGG - Intronic
1006547541 6:34792232-34792254 CGCGGGCCGCGGCTCCGGCATGG + Exonic
1007570979 6:42890697-42890719 CTCCTGCAGCTGGTCCAGCAGGG - Exonic
1007779807 6:44246381-44246403 CTCCGGCTGCGGCCGGGGCAGGG - Intronic
1012540316 6:100354862-100354884 CGCCTGCTTCGGCTCACGCACGG - Intergenic
1014381473 6:120748511-120748533 GCCCTGCTTCGGCTCAGGCATGG - Intergenic
1016820667 6:148343135-148343157 CTCCGGTTCCGGCTCCGGCGCGG - Exonic
1017898971 6:158704406-158704428 TCCCCGCTGCGGCTCCTGCACGG - Intronic
1018317161 6:162568561-162568583 CTCCTTCTCCTGCTCCTGCACGG - Intronic
1019661737 7:2228005-2228027 CTCCTGCTGAGCCCCCGGCGTGG - Intronic
1019778961 7:2928673-2928695 ATGCTGCTGCGGCTCCGGGGGGG + Exonic
1020131676 7:5562464-5562486 CTCCCGCTGAGGCTGCGTCAGGG - Intronic
1020462779 7:8443036-8443058 CCCCCGCTGCCGCTCCGGCTGGG + Intronic
1023126456 7:36959228-36959250 CCCCTGCTGCAGATCTGGCAAGG - Intronic
1023616903 7:42029199-42029221 CTTCTGCTGCTGCTCCTGCCAGG + Intronic
1024694333 7:51839308-51839330 GCCCTGCTGCGGCTCCAGCACGG + Intergenic
1024748130 7:52431189-52431211 CTCCGCCTGCGGCCCCGGCGCGG - Intergenic
1027260521 7:76461769-76461791 CTCGGGCTGCAGCTCCGGCTCGG - Exonic
1027311898 7:76959882-76959904 CTCGGGCTGCAGCTCCGGCTCGG - Intergenic
1028985430 7:97005407-97005429 CCCCGGCTGCAGCTCCGGCTGGG + Intergenic
1029540601 7:101180041-101180063 CTCCAGCTCCGGCTCCGGCGAGG - Exonic
1029550010 7:101232617-101232639 CTGCTGCTGCGGCTCTGACGAGG - Exonic
1029580469 7:101433737-101433759 CTCCTGTTGCTGCTCTGACAGGG - Intronic
1032944210 7:136831348-136831370 GTCCTGCTTCGGCTCGCGCACGG - Intergenic
1034618314 7:152436755-152436777 CTCCGGCTCCGGCTCCGGCTCGG + Intergenic
1035639538 8:1173852-1173874 GCCCTGCTTCGGCTCCCGCACGG + Intergenic
1036952452 8:13154188-13154210 CACCTGGTGCGGCCCTGGCACGG - Intronic
1038170731 8:25128963-25128985 CTCCTGCTGCAGCAGTGGCAGGG - Intergenic
1039048578 8:33472756-33472778 CTCCAGCAGAGGCTCCGGCCCGG + Intronic
1039310502 8:36313437-36313459 CTCCTTCTCCTGCTCCGCCATGG - Intergenic
1039936498 8:42051376-42051398 CTCCGGCTTTGGCTCCGGCCGGG - Intronic
1044115248 8:88327490-88327512 CTGCTGCTGCGGCTGCGACTAGG - Intronic
1044998812 8:97862307-97862329 CTCCAGCTGTGGCTTTGGCAGGG - Intergenic
1046464731 8:114586192-114586214 CCCCTGCTTCGGCTCGTGCATGG + Intergenic
1046739459 8:117812841-117812863 CACCTGCTGCTCCTCAGGCATGG + Intronic
1048299005 8:133237937-133237959 CTCCTACTCCGGCCCCTGCAAGG + Exonic
1049103799 8:140598625-140598647 CTCCTGGTGGGGCTCAGACAGGG - Intronic
1049158926 8:141084907-141084929 GTCCTCCTGCGGCCCCGGGAGGG + Intergenic
1049527240 8:143133573-143133595 CTCCTGCTGCAGCTCCCAAAGGG + Intergenic
1052640550 9:31160915-31160937 ACCCTGCTTCGGCTCAGGCACGG + Intergenic
1053372738 9:37576279-37576301 CGGCTGCTGCGGCTCCAGCGGGG - Intronic
1056278389 9:85015691-85015713 TTCCTGCTGCAGCTCAGGGATGG - Intronic
1057903719 9:98968395-98968417 CTCCTCCTGGGGCTCTAGCAGGG + Intronic
1060197106 9:121631000-121631022 CTCCTGCTGAGGCCCAGGGAGGG + Intronic
1060986862 9:127825076-127825098 CTCCTGCTGCGTCTTCTGCCTGG + Intronic
1061089962 9:128420905-128420927 CTCCAGCTGCTGCTCCTGCTGGG + Exonic
1061327931 9:129875327-129875349 CACCTGCTGTCGCTCCCGCATGG - Exonic
1061445804 9:130636526-130636548 TTCCTGCTGCTGCCCGGGCATGG - Intronic
1061820858 9:133226524-133226546 CCCTAGCTGCGGCTCTGGCAGGG - Intergenic
1062629704 9:137458317-137458339 CTGCTCCTGGGGCTCGGGCAGGG + Intronic
1186495089 X:10006744-10006766 CTCCTGCTGCTGCTTCAGTAGGG - Intergenic
1187883341 X:23865976-23865998 CTCATGCTGCTGCTCTGGCCAGG + Intronic
1188071354 X:25721762-25721784 CTGCTGCTGCTGCTTCTGCAGGG + Intergenic
1188502522 X:30843799-30843821 CTCCTGCTGTGTCTCCTCCAAGG + Intronic
1190289331 X:48981846-48981868 TTCCTGCTGCTGCTGCTGCAGGG + Exonic
1191633520 X:63351174-63351196 ATGCTGGTGCGGCTGCGGCACGG + Exonic
1191758764 X:64624443-64624465 CTCCAGCTGTGGCTTTGGCAGGG + Intergenic
1192795513 X:74421777-74421799 CTCCGGCTGGGGCTCGGGCGGGG - Exonic
1193038411 X:76978765-76978787 ATCCTGCTTCGGCTCACGCATGG - Intergenic
1193817286 X:86119167-86119189 GTCCTGCTTCGGCTCGCGCACGG + Intergenic
1195379069 X:104254363-104254385 CTCCTGCTGTTGCTCCGGCTTGG + Exonic
1195452890 X:105035209-105035231 ATCCTGCTTCGGCTCACGCACGG + Intronic
1196077588 X:111594546-111594568 GTCCTGCTTCGGCTCACGCACGG + Intergenic
1197417379 X:126191070-126191092 GCCCTGCTTCGGCTCGGGCAAGG + Intergenic
1197984182 X:132249993-132250015 GTCCTGCTTCGGCTCACGCACGG + Intergenic
1199336042 X:146620070-146620092 CTCCTTCAGGGGCTCCGCCAGGG + Intergenic