ID: 914993113

View in Genome Browser
Species Human (GRCh38)
Location 1:152515495-152515517
Sequence TCCTGCTGCGGCTCCGGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 341}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993094_914993113 15 Left 914993094 1:152515457-152515479 CCGCCCCGGCGCCCACCCCGGCG 0: 1
1: 0
2: 15
3: 87
4: 671
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993087_914993113 29 Left 914993087 1:152515443-152515465 CCCCGCTCCGTGTCCCGCCCCGG 0: 1
1: 0
2: 2
3: 35
4: 250
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993099_914993113 3 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993095_914993113 12 Left 914993095 1:152515460-152515482 CCCCGGCGCCCACCCCGGCGCCC 0: 1
1: 2
2: 10
3: 103
4: 902
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993089_914993113 28 Left 914993089 1:152515444-152515466 CCCGCTCCGTGTCCCGCCCCGGC 0: 1
1: 0
2: 3
3: 50
4: 409
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993097_914993113 10 Left 914993097 1:152515462-152515484 CCGGCGCCCACCCCGGCGCCCGC 0: 1
1: 0
2: 14
3: 153
4: 1145
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993096_914993113 11 Left 914993096 1:152515461-152515483 CCCGGCGCCCACCCCGGCGCCCG 0: 1
1: 0
2: 3
3: 76
4: 713
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993104_914993113 -9 Left 914993104 1:152515481-152515503 CCGCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993102_914993113 -2 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993101_914993113 -1 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993103_914993113 -8 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993093_914993113 16 Left 914993093 1:152515456-152515478 CCCGCCCCGGCGCCCACCCCGGC 0: 1
1: 1
2: 22
3: 295
4: 1580
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993100_914993113 0 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993098_914993113 4 Left 914993098 1:152515468-152515490 CCCACCCCGGCGCCCGCCTCCTC 0: 1
1: 0
2: 7
3: 61
4: 743
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993091_914993113 22 Left 914993091 1:152515450-152515472 CCGTGTCCCGCCCCGGCGCCCAC 0: 1
1: 0
2: 3
3: 37
4: 400
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341
914993090_914993113 27 Left 914993090 1:152515445-152515467 CCGCTCCGTGTCCCGCCCCGGCG 0: 1
1: 1
2: 0
3: 15
4: 216
Right 914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG 0: 1
1: 0
2: 1
3: 36
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993113 Original CRISPR TCCTGCTGCGGCTCCGGCAG GGG Exonic
900136937 1:1121702-1121724 GCCTGCTGCGGCTGCTGTAGGGG - Intergenic
900409628 1:2506854-2506876 TCCTGCTCCAGCTCCGGCTTCGG + Intergenic
901078995 1:6573015-6573037 TCCAGCTGTGGCTGTGGCAGTGG - Intronic
901213091 1:7537423-7537445 TGCTGCTGTTGCTCGGGCAGGGG - Intronic
901849526 1:12006761-12006783 TCCTGCTGTGGCCCCTGCATTGG + Intronic
902033517 1:13439659-13439681 TCCACCTGCGGCCCCGGTAGGGG + Intergenic
902304076 1:15524156-15524178 TCCTGCGGCGGTGCCGGCTGCGG - Exonic
902369119 1:15994310-15994332 GCCTGCTGTGGCTCCAGCAGTGG - Intergenic
903063793 1:20687239-20687261 GTCTGCTGCGGCTCTGGCACTGG - Intronic
904241446 1:29148847-29148869 TCTTGCTGCGGCTCCTGCTCCGG + Exonic
904241455 1:29148889-29148911 TCCTGCTCCGGCTCCGACTCTGG + Exonic
904263769 1:29306144-29306166 TCCTGCTGCTGCTGCAGCAGGGG - Intronic
905058625 1:35120801-35120823 CCCTGCTCCGGCTCTGGCCGCGG - Intergenic
906140382 1:43530916-43530938 TCCAGCTTCGGCTCCGGCTCGGG + Exonic
906140390 1:43530946-43530968 TCCGGCTCCGGCTCCGGCTCCGG + Exonic
906556592 1:46718992-46719014 CCCTGCTCCGGCTTCGGCCGCGG + Exonic
907200944 1:52726470-52726492 TCGGGCTGCGGCTGCGGCTGCGG + Intronic
907200945 1:52726476-52726498 TGCGGCTGCGGCTGCGGCTGCGG + Intronic
908129138 1:61057298-61057320 GGCTGCGGCGGCTGCGGCAGCGG + Intronic
908764346 1:67540516-67540538 TCCCTCTCCGGCTCCGCCAGAGG + Intergenic
911017218 1:93346083-93346105 TCCAGCAGCGGCAGCGGCAGCGG + Exonic
912993499 1:114511149-114511171 TCTTGCTGCGGCTGCGGCTGGGG - Exonic
913645639 1:120851291-120851313 TCCTTCGCCAGCTCCGGCAGCGG - Intergenic
914001720 1:143699945-143699967 TCCTCCGCCGGCTCCCGCAGCGG - Intergenic
914081072 1:144412235-144412257 TCCTCCGCCAGCTCCGGCAGCGG + Intergenic
914175987 1:145280769-145280791 TCCTCCGCCAGCTCCGGCAGCGG + Intergenic
914514566 1:148362852-148362874 TCCTCCGCCGGCTCCCGCAGCGG - Intergenic
914530708 1:148522251-148522273 TCCTCCGCCAGCTCCGGCAGCGG + Intergenic
914993113 1:152515495-152515517 TCCTGCTGCGGCTCCGGCAGGGG + Exonic
915013221 1:152709190-152709212 TCCTGCTGTGGCTCCAGCTCTGG + Exonic
915066182 1:153225923-153225945 TCCTGCTGCAGCTCCAGCCAAGG + Intergenic
918420962 1:184363869-184363891 TCCTCCTGGGTCCCCGGCAGAGG + Intergenic
920147261 1:203872695-203872717 TCCAGCTTTGGCTCTGGCAGGGG - Intergenic
920448084 1:206035272-206035294 TCCTGGAGCGGCAGCGGCAGCGG - Intergenic
921060247 1:211578955-211578977 TCCTGCTCCTGCTCCGGCTGCGG - Intergenic
921189849 1:212699674-212699696 TGCTGCTGCGGCTGCGGCTGCGG + Exonic
922305609 1:224341267-224341289 TCCTGCTGCAGCTCGCGCAGTGG + Intergenic
922481181 1:225940931-225940953 TCCTGCTGCGGCGCAGCCACGGG - Exonic
922832258 1:228609821-228609843 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922832818 1:228612062-228612084 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922833379 1:228614303-228614325 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922833939 1:228616544-228616566 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922834496 1:228618785-228618807 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922835050 1:228621000-228621022 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922835607 1:228623220-228623242 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922836165 1:228625462-228625484 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922836723 1:228627701-228627723 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922837282 1:228629943-228629965 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922837843 1:228632184-228632206 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922838401 1:228634424-228634446 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922838959 1:228636649-228636671 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922839519 1:228638890-228638912 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922840080 1:228641121-228641143 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922840640 1:228643362-228643384 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
922841203 1:228645593-228645615 CCCGGCTGCGGCTGCGGCGGGGG + Intergenic
923000394 1:230002277-230002299 TCCTCCTGCTGCACCTGCAGGGG - Intergenic
923119695 1:230978732-230978754 TCCTGCTGCTGCTGCTGCTGGGG - Exonic
924138577 1:240998520-240998542 TGCTGCTGCTGCTCCAGCTGAGG - Intronic
924583892 1:245345229-245345251 TCCAGCTGCGGGTAGGGCAGGGG - Intronic
924644614 1:245866216-245866238 TCCTTCTGAGGCTGGGGCAGTGG + Intronic
924835073 1:247639517-247639539 TCCTCCCCCGGCTGCGGCAGAGG + Intergenic
1063951028 10:11223671-11223693 TACTGCTGTGACTCCTGCAGGGG - Intronic
1064205692 10:13321731-13321753 TCCAGCTGGGGCTGCGGGAGTGG + Intronic
1070835728 10:79445758-79445780 TCCAGCGGCGGCTCCGGGGGTGG + Intergenic
1071527446 10:86366592-86366614 TCCCGCTCCGGCTCCGGTGGCGG + Intergenic
1072644079 10:97238316-97238338 TCCTGCTGAGGCTGAGGCTGAGG + Intronic
1073101829 10:101010533-101010555 GGCTGCTGCGGCTGCGGCTGCGG + Intronic
1073101831 10:101010545-101010567 TGCGGCTGCGGCTACGGCTGCGG + Intronic
1075390124 10:122085774-122085796 TTCTGCTGCGGGGCCGGCACTGG - Exonic
1075519555 10:123135775-123135797 TGCGGCTGCGGCTCCCGCGGAGG - Intergenic
1077065140 11:637695-637717 TCCAGCTGGGGCGGCGGCAGGGG + Intronic
1077362679 11:2147682-2147704 GCCTGCTGGGGCTCAGGCTGTGG + Exonic
1077495514 11:2884913-2884935 TCCGGCTCCGGCTCCGGCCCCGG - Exonic
1077537271 11:3130435-3130457 TCCTGCTGTGGCTTCAGGAGTGG + Intronic
1080024493 11:27599459-27599481 CCCTGCAGTGGCTCCAGCAGAGG - Intergenic
1080696952 11:34610926-34610948 TCCTGCTGGGGCACAGGGAGAGG + Intergenic
1080781748 11:35435957-35435979 TCCTGCTGCTGCCCAGGCGGCGG + Exonic
1081574299 11:44309734-44309756 TGCTGCTGCGGCTGCGGCTGCGG + Exonic
1081574301 11:44309740-44309762 TGCGGCTGCGGCTGCGGCGGCGG + Exonic
1081863509 11:46347469-46347491 TCCTGGAGCGGCGGCGGCAGCGG + Intronic
1081872542 11:46390116-46390138 TCTGGCTGAGTCTCCGGCAGGGG - Intergenic
1083298555 11:61728232-61728254 GCCTGGTGCTGCTCCGGCAGCGG + Exonic
1083298557 11:61728238-61728260 TGCTGCTCCGGCAGCGGCAGCGG + Exonic
1083373341 11:62199385-62199407 TCCTGCTGCCCCTCAGGCAATGG - Intergenic
1083669392 11:64291757-64291779 CCCCGCTGCGGCTGCGGCTGAGG - Intronic
1083970366 11:66070580-66070602 TGCTGCTGCTGCTGCGGCGGCGG - Exonic
1084284270 11:68121384-68121406 TCCTCGTGCGGCGGCGGCAGAGG - Intronic
1084732100 11:71080257-71080279 TCCTGCTGAGGCCTGGGCAGGGG + Intronic
1085312753 11:75525911-75525933 TCGGGCTGCGGCTCCGGTGGGGG - Intergenic
1088626790 11:111735492-111735514 TGCTGCCGCGGGTCCGGCAGCGG - Intronic
1089700243 11:120240214-120240236 TCCGGCAGCGGCTCCCGCGGCGG + Intronic
1090003997 11:122984328-122984350 TCCTCCTGGGGCCCCGGCAGAGG - Intergenic
1090699382 11:129279914-129279936 TACTGCTGCTGCTGCGGCGGCGG - Intergenic
1092231539 12:6778328-6778350 TCCGGCTCCGGCTCCGGCTCCGG - Exonic
1094486938 12:30933065-30933087 TCATCCTGCGGCTCTGGCAGGGG - Intronic
1095958506 12:47819655-47819677 TCCGGCTCCGGCTCCGGCTCGGG - Intronic
1096191339 12:49622234-49622256 TCCTGCCGCGGCGGCGGCTGCGG + Intronic
1096870271 12:54588424-54588446 TCAAGGTGCGGCTCCAGCAGCGG + Exonic
1097029328 12:56080179-56080201 GGCTGCTGCGGCGACGGCAGCGG - Exonic
1099133519 12:78864788-78864810 TCCTCCTGCAGCAGCGGCAGCGG + Exonic
1099640748 12:85280502-85280524 GGCTGCGGCGGCTCCGGCTGGGG - Intronic
1100291000 12:93214909-93214931 TCTTGCTGCGGCTGCTGCCGGGG + Intergenic
1101311785 12:103587201-103587223 TCCTGCAGGGGCTGAGGCAGAGG - Intergenic
1101605915 12:106247724-106247746 GGCTGCTGCGGCGCCGGCGGCGG + Exonic
1103209578 12:119156699-119156721 TCCTGCTCCGGCTCCGGCTGCGG - Exonic
1103209585 12:119156723-119156745 TCCTGCTCCGGCTCCGGCTCCGG - Exonic
1103881213 12:124167254-124167276 TTCAGCCGTGGCTCCGGCAGTGG + Intronic
1105209400 13:18249029-18249051 TCCTGCTGGGGCTGGGGCTGGGG - Intergenic
1106584702 13:31046864-31046886 TGCTGCTGCCACTCCTGCAGTGG + Intergenic
1108373414 13:49792532-49792554 TACTCCTGCGGCTGCGGCGGCGG + Exonic
1110257342 13:73446126-73446148 TCTTGCTCCGGCTCTGGCCGTGG - Intergenic
1110404629 13:75136101-75136123 TTCTCCTGGGGCTCTGGCAGTGG - Intergenic
1112622371 13:101065511-101065533 TCCTGCTGCGGCTACTGCGTGGG - Exonic
1114269572 14:21092545-21092567 TCCGGCTCCGGCTCCGGCTGGGG + Exonic
1114325660 14:21586636-21586658 TCCTGCTGCTGCTGCTGCAGCGG + Intergenic
1114612524 14:24052122-24052144 TGCTGCTGAGGCTGCTGCAGAGG - Exonic
1115028394 14:28767472-28767494 TGCTGCTGCGGCGGCGGCGGCGG - Exonic
1116928711 14:50668410-50668432 TCCAGGCGCGGCTCCGGCGGCGG + Intergenic
1118140191 14:63072272-63072294 GCTTGCTGCGGCTGCTGCAGGGG + Intronic
1119840706 14:77790761-77790783 TCCTGCTGGTGTTCGGGCAGTGG - Intergenic
1122236156 14:100331677-100331699 TCCTGGCCCGGCTCTGGCAGTGG + Intergenic
1122394048 14:101410163-101410185 TCCTGCTATGGCTCAGGCTGGGG - Intergenic
1122886600 14:104713115-104713137 CGCTGCTGCGGCTCAGGGAGGGG + Intronic
1124638123 15:31377931-31377953 TCTTGCAGAGGCTCCGGGAGGGG + Intronic
1125390314 15:39185312-39185334 TCCTGCTGCTGCTCTGCCACTGG + Intergenic
1125874353 15:43131079-43131101 TCCAGGTGCGGCACAGGCAGTGG + Intronic
1125879982 15:43185435-43185457 TCGCAGTGCGGCTCCGGCAGTGG + Exonic
1127117543 15:55743040-55743062 CCCCGCTCCGGCTCCGGCACCGG + Intronic
1127606515 15:60592492-60592514 TGCTGCTGTGGCTCGGGCGGCGG - Intronic
1127877274 15:63122103-63122125 TCCTGTGGCGGCTCGGCCAGAGG - Exonic
1128028609 15:64460691-64460713 TCCGGCTCCGGCTCCGGCTCTGG - Intergenic
1129333538 15:74839651-74839673 TACTGCAGCGGCTCCTGGAGCGG - Exonic
1130411674 15:83653646-83653668 CCCTGCTCCGGCTCCGGCTGAGG + Intergenic
1131300232 15:91193202-91193224 TCCTCCTGCGGCACTTGCAGGGG - Intronic
1132568560 16:634307-634329 TGCTGCTGGAGCTCGGGCAGTGG - Intergenic
1132747132 16:1441503-1441525 TCCTGCTGTGGCCTCAGCAGGGG - Intronic
1135716750 16:24777106-24777128 TGCTGCTGCGGCTGCGGCTGTGG - Exonic
1136500876 16:30669227-30669249 GGCTGCTGCGGCGGCGGCAGCGG - Exonic
1136684986 16:31988773-31988795 TCCTGCTGCAGCTGGGGCATGGG + Intergenic
1136785600 16:32932308-32932330 TCCTGCTGCAGCTGGGGCATGGG + Intergenic
1136884171 16:33921496-33921518 TCCTGCTGCAGCTGGGGCATGGG - Intergenic
1137731471 16:50693586-50693608 TCCGGCTCCGGCTCGGGCTGCGG - Intronic
1139335908 16:66231024-66231046 TCCTGCAGCGGCTGTGGCCGAGG - Intergenic
1139509127 16:67416382-67416404 TCCGGCTCCGGCTCCGGCTCCGG + Exonic
1139509129 16:67416388-67416410 TCCGGCTCCGGCTCCGGCTCCGG + Exonic
1139509131 16:67416394-67416416 TCCGGCTCCGGCTCCGGCTCCGG + Exonic
1139717524 16:68825467-68825489 TCCTGCTGCTGCTGCCTCAGTGG + Intronic
1141453321 16:84120205-84120227 TCCTGGGGCTGCTCAGGCAGGGG - Intergenic
1142031030 16:87838735-87838757 TCCTGCTTCGGCTCCGTCAATGG - Exonic
1143130852 17:4676074-4676096 TCCTTCTCCAGCTTCGGCAGAGG - Exonic
1143862963 17:9904717-9904739 CCCTGCTGCAGCTGCTGCAGAGG - Intronic
1144205086 17:12974222-12974244 TCCAGGGGCTGCTCCGGCAGCGG - Exonic
1145208759 17:20997965-20997987 GCCTGCTGTGGCTGCGGCAGGGG - Intergenic
1145306602 17:21678947-21678969 TCCTGCTGCAGCCGCGGCGGGGG + Intergenic
1145306839 17:21680111-21680133 TCCTGCTGCAGCCGCGGCGGCGG + Intergenic
1145307068 17:21681273-21681295 TCCTGCTGCAGCCGCGGTAGCGG + Intergenic
1145307521 17:21683603-21683625 TCCTGCTGCAGCGGCGGCGGCGG + Intergenic
1145307752 17:21684768-21684790 TCCTGCTGCAGCGGCGGCGGCGG + Intergenic
1146927919 17:36757710-36757732 TCCTTCTGCAGCTCTGGCTGTGG - Intergenic
1147145927 17:38484454-38484476 TCCTGCTGCAGCTGAGGCATGGG + Intronic
1147162924 17:38578450-38578472 TGCGGCTGCGGCTGCGGCCGCGG - Intronic
1147162926 17:38578456-38578478 CCCGGCTGCGGCTGCGGCTGCGG - Intronic
1147323112 17:39657818-39657840 CCGTGCTGCGGCTCCGGCACTGG + Exonic
1147535079 17:41315541-41315563 GGCTGCTGCGGCTCCTGCTGTGG - Exonic
1147537328 17:41329087-41329109 ACCTGCTGTGGCTGCAGCAGTGG - Intergenic
1148002730 17:44399187-44399209 TGCTGCTGCGGCTGCGGCCCCGG + Exonic
1148105954 17:45118969-45118991 TCCTGCGGCGGCTGCTGAAGCGG - Exonic
1148443091 17:47721775-47721797 TACTGCTGAGGCTGCGGCAGGGG + Intergenic
1150239829 17:63622584-63622606 TCCGGCTCCGGCTCCGCCCGCGG - Exonic
1152149234 17:78588750-78588772 TCCTGCTGCGTTCCCAGCAGAGG + Intergenic
1152388683 17:79990364-79990386 TCCTGTTGCAGCCCGGGCAGAGG + Intronic
1152588463 17:81199536-81199558 TTCTGTTGCAGCTCCTGCAGTGG + Exonic
1152735938 17:81996784-81996806 TCCTGCTCCTGCTCCTGCTGGGG - Exonic
1152799083 17:82322770-82322792 ACCTGCTGGGGCTCCAGGAGAGG - Intronic
1153238759 18:3012840-3012862 TCCTGCGGCGGCGGCGGTAGGGG + Intronic
1153474950 18:5489068-5489090 TCCTTGGGCGGCTCCGGCACGGG + Exonic
1158396344 18:57081113-57081135 TGCTGCTGCTGCACCTGCAGAGG + Intergenic
1158976507 18:62715763-62715785 TGCTGCTGCTGCTGCCGCAGCGG - Exonic
1160441481 18:78896162-78896184 TGCTGCTGCTGCTGCGGCTGAGG - Intergenic
1160928016 19:1556230-1556252 CCCTACAGCGGCTCCGGCAACGG - Exonic
1160987800 19:1847751-1847773 TCCGGCCGCGCCTCTGGCAGCGG - Intronic
1161235654 19:3196794-3196816 TGCTGCTGCAGCACTGGCAGGGG + Intronic
1161264822 19:3359421-3359443 GGCTGCGGCGGCTCCGGCTGCGG - Intergenic
1161811728 19:6475373-6475395 CCCTGCTGAGGCTCCGGCTCAGG - Exonic
1163160973 19:15464039-15464061 TCCTGCTCCGGCTCCGGGTCTGG + Exonic
1163235333 19:16026334-16026356 ACCTGTTGCGGCTGCAGCAGTGG - Intergenic
1163498031 19:17658007-17658029 TCCTGCTGTGTCTCCTGGAGTGG - Intronic
1164594918 19:29526386-29526408 GCCCGGTGCGGCTCCGGCGGGGG - Intergenic
1165058715 19:33194708-33194730 TCCGGCTGCGGCTCCGGCTCTGG - Exonic
1165058719 19:33194720-33194742 TCCGGCTCCGGTTCCGGCTGCGG - Exonic
1165601641 19:37059253-37059275 TCCTGCTGCAGCCGCGGCGGCGG - Intronic
1165762089 19:38327335-38327357 TGCTGGTGCGACTCCGGCTGGGG - Exonic
1166732592 19:45067478-45067500 TGCGGCTGCGGCTCTGGCTGGGG - Exonic
1166732596 19:45067490-45067512 TGCGGCTGCGGCTGCGGCTGCGG - Exonic
1166732597 19:45067496-45067518 TCTGGCTGCGGCTGCGGCTGCGG - Exonic
1166733484 19:45071358-45071380 TCCTGCTGCGCCCCAGGCACTGG + Intergenic
1166888035 19:45973380-45973402 TGCTGCGGCGGCTGCGGCGGCGG + Exonic
1167464318 19:49642212-49642234 TCGGGCTGCGGCTCCGGCCCCGG - Exonic
1167578491 19:50328958-50328980 TGCTGCTGCTGCGGCGGCAGCGG + Exonic
1168353191 19:55687900-55687922 GCCTGCTGCGGCTCCGGGCAAGG + Intronic
1168402182 19:56091898-56091920 TGCGGCTGCGGCTGCGGCTGCGG - Intronic
1168402183 19:56091904-56091926 TTCGGCTGCGGCTGCGGCTGCGG - Intronic
926130210 2:10298250-10298272 TCCTGCTGCAGCTGCTGCTGGGG + Intergenic
928155199 2:28870227-28870249 TCTTGCTGTGCCTGCGGCAGGGG - Exonic
928537049 2:32251138-32251160 TGCTGCTGAAGCTGCGGCAGAGG - Exonic
930136094 2:47905560-47905582 TGCTGCTGCTGCTGCGGCGGCGG + Exonic
930136096 2:47905566-47905588 TGCTGCTGCGGCGGCGGCGGAGG + Exonic
934891125 2:98070210-98070232 TCCTACTGCGGCTCAGCCAAAGG + Intergenic
935592509 2:104855453-104855475 TGCTGCTGCGGCGGCGGCGGCGG + Intergenic
935592694 2:104856082-104856104 GGCGGCTGCGGCTGCGGCAGCGG - Exonic
935658075 2:105441942-105441964 TGCTGCTGAGGCTGCGGCTGAGG - Intergenic
936245888 2:110827140-110827162 TCCTGCTGTGGGTCTGGCACTGG + Intronic
938219998 2:129557663-129557685 TCCTGCTGCAGCTGCAACAGAGG + Intergenic
940784977 2:157971655-157971677 TCTTGCTGCGGCTCCTGTTGGGG + Intronic
942946232 2:181677930-181677952 TCCTGCAGCGACACTGGCAGGGG - Exonic
945058823 2:205890917-205890939 TACTGATGTTGCTCCGGCAGGGG - Intergenic
945270243 2:207930991-207931013 CCGTGCTGCGGCTGCGGCAGCGG - Exonic
947741665 2:232487584-232487606 TCCGGCTGCGGCTGCGGCTGCGG - Intronic
947741667 2:232487596-232487618 CTCGGCTGCGGCTCCGGCTGCGG - Intronic
948850033 2:240701337-240701359 TGCTGCTGCGGCGCCAGCCGCGG + Intergenic
1171524517 20:25798669-25798691 TCCTGCTGCTGCCACGGCGGCGG + Intronic
1171532489 20:25861769-25861791 TCCTGCTGCAGCCGCGGCGGCGG + Intronic
1171532821 20:25863426-25863448 TCCTGCTGCAGCCGCGGCGGCGG + Intronic
1171533706 20:25868319-25868341 TCCTGCTGCAGCTGCGGCGGCGG + Intergenic
1171552310 20:26057214-26057236 TCCTGCTGCTGCCACGGCGGCGG - Intergenic
1171847142 20:30284075-30284097 TCCTGCTGCCGCCGCGGCGGCGG - Intergenic
1172654798 20:36530079-36530101 TCCTGCTTCTGCTGTGGCAGGGG + Intergenic
1173303626 20:41827396-41827418 TCCTGCTGGGGCTCCAGGGGAGG + Intergenic
1175247765 20:57591872-57591894 TGCTGCTGGGGCGCCGGGAGGGG + Intergenic
1175267653 20:57712160-57712182 TCCATCTGCGACACCGGCAGTGG + Intergenic
1176020246 20:62959005-62959027 TCCTCCTCCAGCTCCTGCAGTGG - Intronic
1176424216 21:6538094-6538116 TCCTGCTGCAGCTCACCCAGAGG + Intergenic
1176679686 21:9812792-9812814 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1176681392 21:9821251-9821273 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1176681957 21:9824069-9824091 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1176685054 21:9839552-9839574 TCCTCCTGCTGCTGCGGCGGCGG + Intergenic
1176740454 21:10596661-10596683 CCCTGCTACATCTCCGGCAGTGG - Intronic
1179699709 21:43146409-43146431 TCCTGCTGCAGCTCACCCAGAGG + Intergenic
1179881639 21:44295544-44295566 TCCTGCAACTGCTCCCGCAGCGG + Intronic
1180559006 22:16601252-16601274 TCCGGCTCCGGCTCCGGCTCGGG - Intergenic
1180766870 22:18350371-18350393 TCCTGCTGGGGCTGGGGCTGGGG + Intergenic
1180779443 22:18512007-18512029 TCCTGCTGGGGCTGGGGCTGGGG - Intergenic
1180812159 22:18769328-18769350 TCCTGCTGGGGCTGGGGCTGGGG - Intergenic
1181167977 22:20993436-20993458 TCCTGCTGTGGAGCCGGCCGTGG + Intronic
1181198318 22:21203575-21203597 TCCTGCTGGGGCTGGGGCTGGGG - Intergenic
1181419147 22:22785814-22785836 GCCTGCTGCTGCTCCTGCTGGGG - Intronic
1181467891 22:23120052-23120074 TCCTGATGAGGCTGCCGCAGTGG + Intronic
1183547090 22:38460185-38460207 TCCCGCTGCTGCTCCTGCTGTGG + Intergenic
1183601726 22:38843962-38843984 TCCGGCTCCGGCTCCGGCTCCGG - Exonic
1183601728 22:38843968-38843990 TCCGGCTCCGGCTCCGGCTCCGG - Exonic
1183601730 22:38843974-38843996 TCCAGCTCCGGCTCCGGCTCCGG - Exonic
1184099098 22:42332357-42332379 TCCTGCTCCAGCTCCTGCACTGG - Intronic
1184200687 22:42967226-42967248 TCCTGCTGCACCTCTGGCTGTGG + Intronic
1184313389 22:43663832-43663854 GCATGCTGGGGCTCCGGCAAGGG - Intronic
1184465888 22:44668742-44668764 TCCGGCTCCGGCTCCGGCTCTGG + Intronic
1184871260 22:47239953-47239975 ACCTGCAGCGGCTGGGGCAGGGG - Intergenic
1185275460 22:49948684-49948706 TCCTGCTGCTGCCAGGGCAGAGG + Intergenic
1203228489 22_KI270731v1_random:91262-91284 TCCTGCTGGGGCTGGGGCTGGGG + Intergenic
949507436 3:4740665-4740687 TCCTGCCCCGGCTCCTGCAATGG + Intronic
953435644 3:42875139-42875161 CCCTGCTGTGGCCCCGGGAGTGG - Exonic
953775643 3:45814632-45814654 TCCTCCTGCCTCTCCAGCAGCGG - Intergenic
954615553 3:51967339-51967361 TCCTGCGGCGGCGGCGGCGGCGG + Exonic
961741706 3:129037083-129037105 ACGTGCTGCAGCTCCTGCAGAGG + Exonic
962854286 3:139330055-139330077 TGCTGCTGCTGCTGCTGCAGTGG + Intronic
965544649 3:169903202-169903224 TCCTGCTGCATCCCAGGCAGAGG - Intergenic
965648411 3:170908593-170908615 TACAGCAGCGGCGCCGGCAGCGG + Exonic
966117691 3:176485184-176485206 TCTTGCTGTGGCTGCTGCAGAGG + Intergenic
966235808 3:177700582-177700604 TCATGCTGTGGCACCTGCAGTGG - Intergenic
968609075 4:1548994-1549016 CCCTGCTGCGGCTCCGGGGCCGG + Intergenic
968811524 4:2801567-2801589 GCCTGCTGCAGCCCCAGCAGAGG + Intronic
969310044 4:6347759-6347781 TCCTGGTGCAGCTGCTGCAGGGG - Intronic
969394208 4:6910019-6910041 ACCTGCTGCAGCGCCGGCCGAGG + Intronic
970202892 4:13627517-13627539 TGCGGCTGCGGCTGCGGCGGGGG + Exonic
971881235 4:32376367-32376389 TCCTTCTACTTCTCCGGCAGAGG + Intergenic
972686914 4:41360776-41360798 TCCTGCGGCGGCGACGGCGGCGG + Exonic
972725775 4:41745777-41745799 TCCTGCGGCGGCGGCGGCGGCGG - Exonic
973144195 4:46804777-46804799 TCCACCTGCGGCCCCGGTAGGGG - Intronic
973754854 4:54064568-54064590 TGCTGCTGCGGCGGCGGCAGCGG - Exonic
976765355 4:88592694-88592716 TCCTCCCGTGGCTCCGGCGGCGG + Intronic
979582786 4:122379620-122379642 TGCTGCTGCGCCTCAGGCCGGGG - Intronic
980823972 4:138052375-138052397 TCCTGCTGCTGCTCAGGCTTTGG - Intergenic
983032203 4:162817095-162817117 ACCGGCTGGGGCTGCGGCAGAGG + Intergenic
984906029 4:184626545-184626567 ACCTGCTGAGGCTCTGACAGAGG - Intergenic
985599115 5:816413-816435 TCCAGCTGCGGGACAGGCAGTGG + Intronic
985773587 5:1828018-1828040 ACCTGCTCCGGCTCCCGCTGCGG - Intergenic
986330465 5:6713472-6713494 TCCTGCGGCGGCGGCGGCGGCGG - Intergenic
989367939 5:40677197-40677219 GCCAGCTGCGGCTCAGGAAGGGG + Intergenic
991216853 5:64165855-64165877 ACTCGCTGCGGCTCCGGCGGCGG - Intronic
992228373 5:74640578-74640600 TCCTTCCGCGGCGCCTGCAGTGG - Exonic
994647691 5:102491338-102491360 TCCACCTGCGGCCCCGGTAGGGG - Intronic
996124145 5:119706107-119706129 TCCTGCTGCGGCTGCTGTGGGGG + Intergenic
996862879 5:128084513-128084535 TCCGGCGGCGGCGGCGGCAGTGG + Exonic
997228720 5:132228038-132228060 TCCGGCTCCGGCTCCGGCTCCGG - Intronic
997233065 5:132257700-132257722 TCCGGCTCAGGCTCCGGCTGCGG + Exonic
997613253 5:135229765-135229787 TCCTGCTGCTGTTCCTCCAGAGG + Intronic
997691208 5:135828695-135828717 TCCTGCTGCTGCTCTGCGAGTGG - Intergenic
998130868 5:139650469-139650491 CCCTGGGGCGGCTCCGGCGGGGG - Intronic
1001172264 5:169430716-169430738 TCATGCTGTGGCCCCGGCTGGGG - Intergenic
1001894423 5:175366068-175366090 TCCTGCTGCTGATCCAACAGGGG - Intergenic
1001995479 5:176153993-176154015 CTCTGCTGAGGCTCAGGCAGTGG - Intergenic
1002061977 5:176630497-176630519 TCCGGCTCCGGCTCCGGCTCCGG + Intronic
1002136315 5:177110045-177110067 TCCGGCTCCGGCTCCGGCTCCGG + Intergenic
1002136319 5:177110051-177110073 TCCGGCTCCGGCTCCGGGAAGGG + Intergenic
1004216846 6:13711468-13711490 TGCTGCTGCGGCGGCGGCGGCGG + Exonic
1004615076 6:17281527-17281549 TGCGGCTGCGGCTCGGGCAGCGG - Exonic
1004615078 6:17281533-17281555 TCCGGCTGCGGCTGCGGCTCGGG - Exonic
1006319689 6:33313243-33313265 TCCTGCTGAGGCTCTGGCTGTGG + Exonic
1007236032 6:40392104-40392126 TGCTGCTGCGGCGGCGGGAGGGG - Exonic
1007342577 6:41200973-41200995 TCCTGCTGCTGCTGCTGCTGTGG - Exonic
1007600162 6:43076368-43076390 TCCGGCTGCGGCTGCTGCTGCGG + Intronic
1007625402 6:43243671-43243693 TGCGGCTGCGGCTGCGGCGGCGG - Exonic
1007625406 6:43243677-43243699 GCCCGCTGCGGCTGCGGCTGCGG - Exonic
1007785296 6:44276284-44276306 TCCCGCTGCGGCTGCGCCACAGG - Exonic
1010001764 6:70956191-70956213 GGCAGCTGCGGCTCCGGCTGTGG + Exonic
1014531392 6:122563629-122563651 TCTTGCTGCGGCTGCTGTAGGGG + Intronic
1015994937 6:138987937-138987959 TCCGGCTCCGGCTCCGGCTCCGG + Exonic
1015994939 6:138987943-138987965 TCCGGCTCCGGCTCCGGCCGCGG + Exonic
1018795506 6:167182148-167182170 ACCTGCTGCGGCTGCGGCTGCGG + Exonic
1018820815 6:167372915-167372937 ACCTGCTGCGGCTGCGGCTGCGG - Exonic
1019182091 6:170193786-170193808 TTCTGGAGCGGCTCTGGCAGGGG - Intergenic
1019787020 7:2983556-2983578 TCCTGATGCTGCTCCTCCAGTGG + Intronic
1020006219 7:4784971-4784993 GCCTGCTGCCGCCCCGGGAGCGG + Exonic
1022113037 7:27243130-27243152 TTCTCGGGCGGCTCCGGCAGCGG - Exonic
1023394693 7:39742102-39742124 TCCTGCAGCAGCTCCTGAAGTGG - Intergenic
1023792399 7:43763288-43763310 TCAGGCTGCTGCTCTGGCAGTGG - Intronic
1024313521 7:47991938-47991960 TTCTGGGGCGGCGCCGGCAGTGG - Intronic
1026387374 7:69863707-69863729 TCCAGCTGTGGCTACAGCAGTGG - Intronic
1027232656 7:76281714-76281736 TCCAGCAGCGACTCCGGCAGCGG + Exonic
1029119259 7:98255590-98255612 TCATGCTGCTGCTCTGGCTGTGG + Intronic
1033186493 7:139231590-139231612 TACGGCTGCGGCTCCAGCCGGGG - Exonic
1034618312 7:152436750-152436772 TCCGGCTCCGGCTCCGGCTCCGG + Intergenic
1034618315 7:152436756-152436778 TCCGGCTCCGGCTCCGGCTCGGG + Intergenic
1035094798 7:156345582-156345604 ACCCGCTGCGGCCCAGGCAGAGG - Intergenic
1035305885 7:157931056-157931078 TCTGGCTGCAGCTCCTGCAGCGG - Intronic
1038840826 8:31183313-31183335 TCCTCCTGAAGCTCCGACAGAGG + Intergenic
1039843263 8:41308550-41308572 TTCTCCTGCAGCTCCGGCCGGGG + Intronic
1039936497 8:42051375-42051397 TCCGGCTTTGGCTCCGGCCGGGG - Intronic
1041167346 8:55102681-55102703 TGCTGCTGCTGCGCCGGGAGTGG + Exonic
1041184203 8:55281968-55281990 TCCTGCTGGAGCTCGGTCAGTGG + Intronic
1041792639 8:61714310-61714332 AGCAGCAGCGGCTCCGGCAGCGG - Exonic
1042993597 8:74668053-74668075 TCATGCAGCGACTCCTGCAGAGG - Intronic
1044971562 8:97624994-97625016 TTCTGCGGAGGCTGCGGCAGTGG - Intergenic
1049186045 8:141254147-141254169 GCTTTCTGCGGGTCCGGCAGGGG + Intronic
1049891354 9:73394-73416 TCCTGCTGCGGCTCCGGGGCCGG + Intergenic
1053372737 9:37576278-37576300 GGCTGCTGCGGCTCCAGCGGGGG - Intronic
1054160927 9:61671731-61671753 TCCTGCTGCCGCCACGGCGGTGG + Intergenic
1054447663 9:65385461-65385483 TCCTGCTGCCGCTGTGGCGGCGG - Intergenic
1056711050 9:88991842-88991864 TCCTGCAGCGGCTCTGGGGGAGG - Exonic
1056852307 9:90094839-90094861 TCCTGCAGAGGCTGCTGCAGAGG - Intergenic
1057273790 9:93665587-93665609 TCCTGCCGCGGCCCTGGCAGAGG + Intronic
1058110946 9:101029862-101029884 TGCTGCTGCGGCGGCGGCAGTGG + Intronic
1060197107 9:121631001-121631023 TCCTGCTGAGGCCCAGGGAGGGG + Intronic
1061089963 9:128420906-128420928 TCCAGCTGCTGCTCCTGCTGGGG + Exonic
1061432116 9:130537586-130537608 TCCTCCTGCCCCTGCGGCAGAGG + Intergenic
1061704198 9:132440043-132440065 TGCTGCTGCGGCTGCCGCTGAGG - Intronic
1062162144 9:135086728-135086750 TCCTGCTGCGGTCGCCGCAGAGG + Intronic
1062306110 9:135907786-135907808 TCCTACTGCGCCTGCGGAAGCGG - Intergenic
1062671142 9:137710055-137710077 TCCTGCTGCTGCGTCGGGAGAGG + Intronic
1062729817 9:138102646-138102668 TCCTGCTGCCGCTCCTCCTGTGG + Intronic
1203664856 Un_KI270754v1:15327-15349 TCCTGCTGCCGCTCCGGCGTCGG + Intergenic
1203665421 Un_KI270754v1:18143-18165 TCCTGCTGCCGCCGCGGCGGCGG + Intergenic
1203665699 Un_KI270754v1:19553-19575 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203665989 Un_KI270754v1:20963-20985 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203666848 Un_KI270754v1:25191-25213 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203667135 Un_KI270754v1:26602-26624 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203667997 Un_KI270754v1:30830-30852 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203668283 Un_KI270754v1:32241-32263 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1203669136 Un_KI270754v1:36467-36489 TCCTGCTGCCGCCCCGGCGTCGG + Intergenic
1187064817 X:15823110-15823132 TCCGGCTCCGGCTCCGGCTCCGG - Exonic
1188071355 X:25721763-25721785 TGCTGCTGCTGCTTCTGCAGGGG + Intergenic
1192180547 X:68913128-68913150 TGCGGCTGCGGCTGCGGCTGCGG - Intergenic
1192180548 X:68913134-68913156 TGCTGCTGCGGCTGCGGCTGCGG - Intergenic
1192180549 X:68913140-68913162 TGCTGCTGCTGCTGCGGCTGCGG - Intergenic
1192795512 X:74421776-74421798 TCCGGCTGGGGCTCGGGCGGGGG - Exonic
1196189381 X:112779075-112779097 TCCAGCTGTGGCTCAGGCTGAGG - Exonic
1196384002 X:115128097-115128119 TACTGTTTCTGCTCCGGCAGAGG - Intronic
1199219849 X:145305585-145305607 TCTTGCTGTGGCTCCTGCACTGG - Intergenic
1200093832 X:153648099-153648121 TCCTGCTGCGCCGCCTGCGGAGG + Exonic
1200903973 Y:8462349-8462371 TCCTTCTGTGGCTCTGGCATAGG - Intergenic