ID: 914993115

View in Genome Browser
Species Human (GRCh38)
Location 1:152515504-152515526
Sequence GGCTCCGGCAGGGGCTGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 658}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993109_914993115 -9 Left 914993109 1:152515490-152515512 CCTCCTCCTGCTGCGGCTCCGGC 0: 1
1: 0
2: 9
3: 108
4: 852
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993095_914993115 21 Left 914993095 1:152515460-152515482 CCCCGGCGCCCACCCCGGCGCCC 0: 1
1: 2
2: 10
3: 103
4: 902
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993103_914993115 1 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993096_914993115 20 Left 914993096 1:152515461-152515483 CCCGGCGCCCACCCCGGCGCCCG 0: 1
1: 0
2: 3
3: 76
4: 713
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993101_914993115 8 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993104_914993115 0 Left 914993104 1:152515481-152515503 CCGCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993094_914993115 24 Left 914993094 1:152515457-152515479 CCGCCCCGGCGCCCACCCCGGCG 0: 1
1: 0
2: 15
3: 87
4: 671
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993106_914993115 -3 Left 914993106 1:152515484-152515506 CCTCCTCCTCCTCCTGCTGCGGC 0: 1
1: 9
2: 70
3: 612
4: 6347
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993102_914993115 7 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993098_914993115 13 Left 914993098 1:152515468-152515490 CCCACCCCGGCGCCCGCCTCCTC 0: 1
1: 0
2: 7
3: 61
4: 743
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993100_914993115 9 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993099_914993115 12 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993107_914993115 -6 Left 914993107 1:152515487-152515509 CCTCCTCCTCCTGCTGCGGCTCC 0: 1
1: 2
2: 52
3: 435
4: 4909
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993093_914993115 25 Left 914993093 1:152515456-152515478 CCCGCCCCGGCGCCCACCCCGGC 0: 1
1: 1
2: 22
3: 295
4: 1580
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658
914993097_914993115 19 Left 914993097 1:152515462-152515484 CCGGCGCCCACCCCGGCGCCCGC 0: 1
1: 0
2: 14
3: 153
4: 1145
Right 914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG 0: 1
1: 0
2: 7
3: 91
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993115 Original CRISPR GGCTCCGGCAGGGGCTGCTG CGG Exonic
900109721 1:1000357-1000379 CGCGCCGGGAGGGGCCGCTGGGG + Intergenic
900208081 1:1439998-1440020 GGATGGGGCCGGGGCTGCTGCGG - Exonic
900214165 1:1472211-1472233 GGCTCCGGCCGGGGGTGCTCCGG - Intronic
900221714 1:1512595-1512617 GGCTCCGGCCGGGGGTGCTCCGG - Intronic
900237980 1:1601458-1601480 GCCCCTGGCAGGGTCTGCTGAGG + Intergenic
900392847 1:2441214-2441236 GGGGCCGGCAGGGGCTGCCAGGG - Intronic
900553508 1:3268627-3268649 GGGTGCTGCAGGGGCAGCTGTGG - Intronic
901056032 1:6448980-6449002 GCCTCCGGCAGGGGCGGCGGCGG - Exonic
902236250 1:15059414-15059436 GGCTCTAGCCGAGGCTGCTGGGG + Intronic
902478327 1:16699515-16699537 GCCTCGGGCAGGGGCGGCGGCGG + Intergenic
902730731 1:18367040-18367062 GGCTCAGGGAGGAGCTGCTGGGG - Intronic
902910982 1:19597125-19597147 TGCACCGGCCGGGCCTGCTGGGG - Intronic
903738200 1:25543664-25543686 GGCTGCGGCAGCGGCGGCGGCGG + Exonic
903907684 1:26697417-26697439 GGCTGCGGCGGCGGCAGCTGCGG + Exonic
903969403 1:27109120-27109142 GCCTCCTACTGGGGCTGCTGAGG + Intronic
904042603 1:27593174-27593196 GGCTGGGGCAGGGGCTGAGGTGG + Intronic
904236638 1:29121370-29121392 GGCTCCGCCAGGGGGTGCTGCGG - Exonic
904940766 1:34164066-34164088 GGCTGCGGCAGCGGCAGCGGCGG - Intronic
905067078 1:35192808-35192830 TGCTGCGGCGGTGGCTGCTGCGG + Exonic
905731717 1:40303061-40303083 GGCTCCGGGAGGGGGTGAGGGGG + Intronic
905772988 1:40650195-40650217 GGCTCCACTAGGGGCCGCTGGGG + Intronic
905857530 1:41323841-41323863 GGGTAGGGCAGGGGGTGCTGGGG - Intergenic
906044378 1:42816996-42817018 GGCCCCAGGAGCGGCTGCTGCGG - Intronic
906607372 1:47181573-47181595 GGCTCCTGCAGGGGCTGGGCCGG - Intergenic
906608194 1:47185366-47185388 GCATCCTGCAGGGCCTGCTGTGG - Intronic
907339146 1:53721575-53721597 GCCTTCGGCCAGGGCTGCTGTGG - Intronic
907497221 1:54853165-54853187 GTTTCTGGCTGGGGCTGCTGGGG + Intronic
907775792 1:57513226-57513248 GTCTAGGGCAGAGGCTGCTGGGG - Intronic
908355809 1:63323931-63323953 GGCGGCGGCCGCGGCTGCTGCGG + Exonic
909632358 1:77780147-77780169 AGCTCCGCGAGGGGCTGCTGTGG + Intronic
910758863 1:90716825-90716847 GGCGGCGGCGGCGGCTGCTGTGG + Exonic
911053363 1:93691181-93691203 GGCTCAGGCAGTGGGTGTTGTGG - Intronic
911078970 1:93909381-93909403 GGCTCCGGCTCCGGCTACTGCGG + Exonic
912028316 1:105206243-105206265 TGCCCTGGCAGGGGTTGCTGAGG + Intergenic
912716933 1:111989760-111989782 GGCTGCGGCAGCGGCGGCGGCGG - Intergenic
912793477 1:112675217-112675239 GGCTCCGGGCGGCGCTGGTGGGG - Intronic
913009585 1:114670056-114670078 GCCTTCGGCAGGGCCTGCGGGGG - Intronic
914437035 1:147669797-147669819 GGCCCGGGCTGGGGCTGGTGGGG - Intronic
914713449 1:150235346-150235368 GGCTGCGGCAGGGGCTGAGTGGG + Intronic
914747555 1:150511144-150511166 GGCTGCGGCAGTGGCAGCAGCGG - Exonic
914993115 1:152515504-152515526 GGCTCCGGCAGGGGCTGCTGCGG + Exonic
915070336 1:153261136-153261158 GGCTGCGGCGGGGGCTCCTCCGG + Exonic
915249521 1:154578244-154578266 GGCCCCAGCAGCTGCTGCTGTGG + Exonic
915439128 1:155933723-155933745 GGCTCCTGAAGGAGCAGCTGTGG + Exonic
915536736 1:156540968-156540990 GACTCGGGCAGGGGCTGGTGAGG - Intronic
915657076 1:157369544-157369566 GGGTCAGGCACAGGCTGCTGAGG + Intergenic
915671915 1:157496772-157496794 GGGTCAGGCACAGGCTGCTGAGG - Intergenic
917791838 1:178504086-178504108 GGCTGTGGCAGGTGCAGCTGTGG + Intergenic
917817442 1:178725270-178725292 GGCGGCGGCGGCGGCTGCTGCGG + Exonic
918326881 1:183418353-183418375 GGCTCCGGCGGTGGATGCTGTGG + Exonic
919837184 1:201583017-201583039 GGCTATGGCAGCGGATGCTGAGG - Intergenic
920700155 1:208211903-208211925 TCCTGAGGCAGGGGCTGCTGAGG + Intronic
920825498 1:209421128-209421150 TCCTGGGGCAGGGGCTGCTGAGG - Intergenic
921217539 1:212950636-212950658 GGCTGGGGCTGGGGCTGCTGGGG - Exonic
921884659 1:220293423-220293445 GGCACCAGCAGGGACAGCTGAGG + Intergenic
922315074 1:224434673-224434695 AGCCCCGGCAGTGGCTGCGGCGG + Intronic
922726550 1:227925550-227925572 GGCTCCAGCAGGGCTTCCTGGGG - Intronic
922767929 1:228165740-228165762 GCCACCGCCAGGGGCCGCTGTGG + Intergenic
922902110 1:229145219-229145241 GGCTCTTGCAGGAGCTGCTGAGG + Intergenic
923648221 1:235845815-235845837 GGGTCGTGCTGGGGCTGCTGTGG - Intronic
924723380 1:246644592-246644614 GGCTCCAGCAGGAGCAGCTACGG + Intronic
924740496 1:246791820-246791842 GGCTCCTGCGGGGCCTCCTGAGG + Intergenic
1062814668 10:490576-490598 CGCTCTGGCAGGGGCTCCTGTGG - Intronic
1062828221 10:587642-587664 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828245 10:587734-587756 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828269 10:587826-587848 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828293 10:587918-587940 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828317 10:588010-588032 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828341 10:588102-588124 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062828365 10:588194-588216 GGCTGAGGCAGTGGCTGGTGTGG - Intronic
1062899601 10:1132842-1132864 GGCTGAGGCTGAGGCTGCTGCGG + Intergenic
1062906842 10:1185091-1185113 GGCTCCCCCAAGGGCAGCTGCGG + Intronic
1063025701 10:2177034-2177056 TGCTCCGACAGGGGCTCCTCGGG + Intergenic
1063856788 10:10264124-10264146 GGCTTCTCCAGGGGCTGCTTGGG - Intergenic
1064086579 10:12349944-12349966 GGCCGCGGCAGGGGCTGCACGGG + Intronic
1064561700 10:16600282-16600304 GGCTTCAGCAGGGGTTCCTGGGG - Intronic
1065140284 10:22713800-22713822 AGCCCCGGCGGGAGCTGCTGGGG - Intronic
1065215014 10:23439954-23439976 GGCTCCTGGAGGAGCTGCTGCGG + Exonic
1066022740 10:31319449-31319471 GGCTCCGGCAGCGGCGGCAGCGG - Intronic
1066336030 10:34479607-34479629 GGCACCGGCAGTGGCTGTAGGGG - Intronic
1069775672 10:70925872-70925894 GGCTGAGGGTGGGGCTGCTGGGG - Intergenic
1069788434 10:71004501-71004523 TGCTCCATCTGGGGCTGCTGGGG - Intergenic
1069793162 10:71036219-71036241 GGCTAGGGCAGGGAGTGCTGTGG - Intergenic
1069902873 10:71715985-71716007 GGGCCCGGCAGGGGCTGTCGAGG + Exonic
1069906727 10:71736408-71736430 GGGGCCGGCCAGGGCTGCTGGGG - Intronic
1070329322 10:75406437-75406459 GGCTCCGGCAGTGGCCGTTTGGG - Intergenic
1070398434 10:76032573-76032595 GGCTCCCCCAGGAGCTGCAGCGG - Intronic
1070752701 10:78973577-78973599 GGCGGCTGCTGGGGCTGCTGGGG - Intergenic
1071527451 10:86366601-86366623 GGCTCCGGTGGCGGCTGCGGCGG + Intergenic
1072190934 10:93075478-93075500 AGCTGCGGAAGGGGCTGCGGCGG + Intronic
1073071001 10:100793242-100793264 GCCTGCTGCAGGGGCTGGTGGGG - Intronic
1073476633 10:103757876-103757898 GGCTGCGGCCTGGGCTGCAGTGG + Intronic
1075416363 10:122267496-122267518 GCCTCCGCCAGGGGCTGGTCTGG + Intergenic
1075652805 10:124140299-124140321 GCCTCCATCACGGGCTGCTGTGG - Intergenic
1076020112 10:127065667-127065689 AGCTGCGGAAAGGGCTGCTGAGG - Intronic
1076384300 10:130045848-130045870 GGCTCCGGTCGTGGCTGTTGTGG + Intergenic
1076761359 10:132607512-132607534 GGCTCAGGCAGGGGCGGGTGTGG + Intronic
1076811797 10:132890225-132890247 GGCTCGGGCAGAGGAGGCTGTGG - Intronic
1076815695 10:132913774-132913796 GGCTCAGAAAGGGGCTCCTGTGG + Intronic
1076847211 10:133075198-133075220 GGCCTCGGCAGGGGGTGCTGTGG - Intronic
1076853631 10:133104849-133104871 GGCTGGGCCTGGGGCTGCTGGGG + Intronic
1077034266 11:487321-487343 GGGTCTGGCAGGTGCTGCTCAGG + Intronic
1077077122 11:706851-706873 GGCTGGGACAGGGGCTGCAGAGG + Intronic
1077131926 11:977325-977347 GGCTGTCACAGGGGCTGCTGTGG + Intronic
1077256207 11:1584636-1584658 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077256347 11:1585155-1585177 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077256354 11:1585176-1585198 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077258083 11:1598135-1598157 GGCTCCGGCCGTGGGGGCTGTGG - Exonic
1077258102 11:1598198-1598220 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077261210 11:1621957-1621979 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077261217 11:1621978-1622000 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077261230 11:1622020-1622042 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077261237 11:1622041-1622063 GGCTCCGGCTGTGGGGGCTGTGG - Exonic
1077262420 11:1629892-1629914 GGCTCCGGCTGTGGGGGCTGTGG + Exonic
1077262425 11:1629913-1629935 GGCTCCGGCTGTGGAGGCTGTGG + Exonic
1077262436 11:1629955-1629977 GGCTCCGGCTGTGGAGGCTGTGG + Exonic
1077274448 11:1697276-1697298 GGCTCCGGCTGTGGGGGCTGTGG + Exonic
1077305982 11:1868886-1868908 GGTTCCAGCAGGGGCATCTGGGG - Intronic
1077318211 11:1928545-1928567 GACTCAGGCGGGGGCTCCTGGGG + Intronic
1078536525 11:12179385-12179407 GGCTCTGGGCTGGGCTGCTGGGG - Intronic
1078740282 11:14059738-14059760 GACTGTGGCAGCGGCTGCTGGGG - Intronic
1079353499 11:19712813-19712835 GGCTGCTGCCGGCGCTGCTGCGG - Intronic
1080807014 11:35662940-35662962 CGCCCGGGCAGGGGCTGCCGCGG + Exonic
1081574297 11:44309722-44309744 GGCTGCGGCTGCTGCTGCTGCGG + Exonic
1081585032 11:44378398-44378420 GGCTCCTTCATGGGCAGCTGAGG + Intergenic
1081670362 11:44939012-44939034 GGTGCCGGGAGGGGCTGGTGGGG - Intronic
1081773833 11:45664993-45665015 GGCGCAGGAAGGGGCTGCCGGGG - Intronic
1081905796 11:46668854-46668876 GGCTCCAGCGGGGGCAGCAGTGG + Exonic
1082029507 11:47594265-47594287 CGCTGCGGCAGGGGCGGCGGGGG + Exonic
1082140490 11:48603225-48603247 GGGTCTGGCTGTGGCTGCTGTGG + Intergenic
1082567680 11:54700324-54700346 GGGTCTGGCTGTGGCTGCTGTGG + Intergenic
1083305222 11:61758441-61758463 GGCTCCAGCCGGAGCTGCTTAGG + Intronic
1083679332 11:64343991-64344013 GCCTCCAGCAGGGGGTGCTGAGG - Exonic
1083757813 11:64801006-64801028 GGCTCCCGAGGTGGCTGCTGTGG - Exonic
1083970365 11:66070571-66070593 TGCTGCGGCGGCGGCTGCTGAGG - Exonic
1084040373 11:66539309-66539331 GGGTCTGGCAGGGGCTGCTCAGG - Exonic
1084153195 11:67300771-67300793 GGCCCAGGCTGGGGCTCCTGAGG - Intronic
1084230014 11:67744734-67744756 GCCTCTGGCAGGCCCTGCTGTGG - Intergenic
1084321998 11:68378274-68378296 GGCTCTGGCAGGGGTGGCTCAGG + Intronic
1084503102 11:69546451-69546473 GGCTCCTGCTGGGACAGCTGGGG - Intergenic
1084574715 11:69981716-69981738 GGCGCCTGCAGGGGCTGGGGTGG - Intergenic
1084748436 11:71188347-71188369 GGCCTGGGCATGGGCTGCTGAGG - Intronic
1084798761 11:71527331-71527353 GGCTCCGGCTGTGGGGGCTGTGG + Exonic
1084798768 11:71527352-71527374 GGCTCCGGCTGTGGGGGCTGTGG + Exonic
1084800100 11:71538086-71538108 GGCTCCGGCTGTGGGGGCTGCGG + Exonic
1084803865 11:71565639-71565661 GGCTCCGGCTGTGGGGGCTGTGG + Exonic
1084806493 11:71582764-71582786 GGCTCCGGCAGTGGGGGCTGTGG - Exonic
1085512474 11:77095351-77095373 GGCTCAGTCAGGGGCTGAAGGGG + Intronic
1086455370 11:86955108-86955130 GGCAGCGGCTGGGGCTGCTCTGG + Exonic
1087904158 11:103676100-103676122 GGATCCAGAAGTGGCTGCTGAGG - Intergenic
1088172830 11:107017828-107017850 GGCCCCGGCAGTGGCAGCGGCGG + Exonic
1088172850 11:107017882-107017904 GGCGGCGGCAGCGGCAGCTGCGG + Exonic
1088700065 11:112403608-112403630 AGGTCCAGCTGGGGCTGCTGTGG + Intergenic
1089004834 11:115082737-115082759 GGGTGCTGCAGGGGCTGCTTGGG - Intergenic
1089452353 11:118607434-118607456 GGCTGGGGGAGGTGCTGCTGTGG + Intronic
1089494553 11:118901703-118901725 GGGTCCGTGAGGAGCTGCTGCGG - Exonic
1089643922 11:119865548-119865570 GGCTCCCGCAGGAGAGGCTGAGG - Intergenic
1089700242 11:120240211-120240233 GGCTCCGGCAGCGGCTCCCGCGG + Intronic
1089729451 11:120511500-120511522 GGGAACGGCGGGGGCTGCTGCGG - Intergenic
1089966203 11:122656373-122656395 GGCTCCGGGCGGGGGTGCGGGGG + Intronic
1091223493 11:133944575-133944597 GGCTGGGGCAGGGCCAGCTGGGG - Intronic
1091453736 12:589994-590016 GGATCAGGGAGGGGCTGATGAGG + Intronic
1091675757 12:2488238-2488260 GGCTCCTGCAAGGGCGGGTGAGG + Intronic
1091768711 12:3138053-3138075 GGCTCCTGAAGGGAGTGCTGAGG - Intronic
1092335412 12:7628714-7628736 GGCGGCGGCAGGGGCGGCGGCGG - Intergenic
1092335422 12:7628741-7628763 GGCGGCGGCAGGGGCGGCGGCGG - Intergenic
1092335428 12:7628756-7628778 GGCGGCGGCAGGGGCGGCGGCGG - Intergenic
1092609167 12:10153790-10153812 GGTTCCGGCACGGGCTGCGACGG + Intergenic
1092804535 12:12207416-12207438 GGCTGAGGCAGGGGAGGCTGAGG + Intronic
1093228359 12:16513455-16513477 GGCTCTGGCAGGGGCATCAGAGG - Intronic
1093547657 12:20368164-20368186 GGCTGGAGCAGGGGCTGCTGAGG - Intergenic
1096469939 12:51869473-51869495 GGGTCCGGGAGGGGCGGCTCTGG + Intergenic
1096489767 12:52007132-52007154 GGCTGCGGCAGGGGGTCCCGGGG - Exonic
1096573909 12:52540804-52540826 GGAACCACCAGGGGCTGCTGGGG - Intergenic
1096688802 12:53306961-53306983 GGCTCTGGCAGGGGCAGCCTGGG - Exonic
1097192233 12:57225051-57225073 GGCCCGGGCAGGGGCAGCCGGGG + Exonic
1097221810 12:57455556-57455578 AGCTCTGGCTGGTGCTGCTGTGG + Exonic
1097232824 12:57522731-57522753 GGCTCCTGCGGCGGCGGCTGCGG + Exonic
1099689874 12:85938814-85938836 GGCTATGACAGGGGTTGCTGGGG - Intergenic
1101605912 12:106247712-106247734 GGCGGCGGCGGCGGCTGCTGCGG + Exonic
1101817882 12:108159755-108159777 AGATGCTGCAGGGGCTGCTGGGG - Intronic
1102143800 12:110638744-110638766 GGCTCCAGCAGAGGCTGGTATGG + Intronic
1103930232 12:124446242-124446264 GGCCCCTGCAGGAGCTGCCGAGG - Intronic
1104289646 12:127455835-127455857 GGCTGGGGCTGGGGCGGCTGCGG + Intergenic
1104356038 12:128087951-128087973 TGCTCTGGAAAGGGCTGCTGGGG + Intergenic
1104425825 12:128677466-128677488 GGCTTAGGTGGGGGCTGCTGGGG + Intronic
1104682919 12:130763642-130763664 GGCTCCTGGAGGGGCTGCCCAGG + Intergenic
1104841162 12:131826626-131826648 GTCTCTGGCTGGGCCTGCTGAGG + Intergenic
1104910528 12:132238177-132238199 GACGCGGGCAGGGGCTGCTCAGG + Intronic
1105472400 13:20704781-20704803 GGCCCGGGGAGGTGCTGCTGGGG + Intronic
1105839908 13:24245126-24245148 GACTCCGGCGTGGGCTGCCGGGG - Intronic
1105927144 13:25018499-25018521 GGCTCCGGCGGGGGCTGGCGGGG + Intergenic
1106239918 13:27903331-27903353 GGCAGCGGCAGGGGCTTCTGAGG + Intergenic
1107666239 13:42693827-42693849 GGGTCCTGCAGCGGCTGCTGTGG + Intergenic
1107958973 13:45542571-45542593 GGCTGCAGGAAGGGCTGCTGTGG - Intronic
1108541909 13:51453063-51453085 AACTCGGGCAGGGGCTGCGGAGG + Intronic
1110340906 13:74388892-74388914 TTCTCCGGCAGGGCGTGCTGTGG + Intergenic
1110558399 13:76885733-76885755 GGCCCCGGGCCGGGCTGCTGGGG + Exonic
1111397092 13:87677792-87677814 GGCTGCTGCTGTGGCTGCTGCGG - Exonic
1112214781 13:97419036-97419058 TGCTCTGGCAGGGACTGATGAGG - Intergenic
1113601090 13:111568722-111568744 GGCTGGGGCCGGGGCTGCAGTGG - Intergenic
1113657536 13:112077867-112077889 CGCTGCGGCAGGGGCTGCAGGGG - Intergenic
1113660191 13:112102319-112102341 GGCGCCGGGAGGGGCTGTGGTGG - Intergenic
1113710093 13:112457498-112457520 GGCGCAGGCACAGGCTGCTGAGG - Intergenic
1113784248 13:112994130-112994152 GTCTCGGGCAGGGGCAGGTGTGG + Intronic
1113784272 13:112994251-112994273 GTCTCGGGCAGGGGCTGGCGTGG + Intronic
1113917521 13:113883432-113883454 GACGCCCGCAGGGGCCGCTGAGG - Intergenic
1114267995 14:21083908-21083930 GGCTCCTGGAGGAGCTCCTGAGG + Exonic
1114866201 14:26598006-26598028 CGCTCCGGCAGCGGCGGCGGCGG - Intergenic
1117602755 14:57391298-57391320 GCCTCCGTCAGGGGTGGCTGTGG - Exonic
1118140195 14:63072281-63072303 GGCTGCTGCAGGGGATGGTGGGG + Intronic
1118220873 14:63853464-63853486 GGCTCGGGCAGGCGCTGCGCGGG + Intronic
1119743093 14:77026910-77026932 TGCTCCCCCAGGGGCTCCTGGGG - Exonic
1119777692 14:77258798-77258820 CAGTCCGGCAGGGGCTGCAGGGG - Exonic
1121312950 14:92944988-92945010 GGCTACAGCAGGTGCAGCTGCGG - Intronic
1121314481 14:92952978-92953000 GACTCAAGGAGGGGCTGCTGGGG - Intronic
1121335696 14:93076401-93076423 GACTCCGACAGGGGCTTCTCGGG - Intronic
1121651501 14:95562328-95562350 GACCCCGGCAGTAGCTGCTGAGG + Intergenic
1121719140 14:96097152-96097174 GGCTCCTGCAGGTGCTGCTGGGG + Intergenic
1122145735 14:99687949-99687971 GGCACCTGCAGGGGGCGCTGGGG - Intronic
1122230440 14:100304193-100304215 GAGCCAGGCAGGGGCTGCTGGGG + Intronic
1122293722 14:100693537-100693559 GACTCAGGCAGGGGCAGGTGGGG - Intergenic
1122394046 14:101410154-101410176 GGCTCAGGCTGGGGCTCCTCCGG - Intergenic
1122421431 14:101579856-101579878 AGCTCAGGCAGGGCCAGCTGGGG - Intergenic
1122445043 14:101761850-101761872 GGCGGCGGCAGGGGCGGCGGCGG + Exonic
1122657927 14:103274202-103274224 GGTGCCTGCCGGGGCTGCTGCGG - Intergenic
1122782619 14:104150082-104150104 GGCTCCTGCAGTGTCTGCTCTGG + Intronic
1122905031 14:104797663-104797685 GGCTGCTGCTGGGACTGCTGAGG + Intergenic
1122920277 14:104877108-104877130 AGCTCCTTGAGGGGCTGCTGAGG - Intronic
1122947647 14:105020581-105020603 GGCTCCGACAGAGGGGGCTGCGG + Intronic
1122952659 14:105054202-105054224 TGCCCCGCCCGGGGCTGCTGTGG - Intronic
1123017273 14:105381370-105381392 GGCTGAGGCAGGGGCTACTCAGG - Intronic
1123047629 14:105526585-105526607 GGCCCCGGCAGTGGCGGCAGAGG + Exonic
1123048900 14:105531318-105531340 GGCGCTTGGAGGGGCTGCTGGGG - Intergenic
1123106546 14:105844456-105844478 GTCACGGGGAGGGGCTGCTGCGG + Intergenic
1123122823 14:105926020-105926042 TGATCCTGCAGAGGCTGCTGAGG + Intronic
1123475809 15:20592142-20592164 TGCACCTGCAGGGGCTGCGGAGG - Intergenic
1123642201 15:22408221-22408243 TGCACCTGCAGGGGCTGCAGAGG + Intergenic
1123643943 15:22423945-22423967 GGCGAAGGCATGGGCTGCTGGGG - Intergenic
1123734368 15:23171420-23171442 GGCGAAGGCATGGGCTGCTGGGG + Intergenic
1124209917 15:27754071-27754093 GGCTGTGGCAGGGGCTCCTCCGG + Intergenic
1124284874 15:28392728-28392750 GGCGAAGGCATGGGCTGCTGGGG + Intergenic
1124297823 15:28518886-28518908 GGCGAAGGCATGGGCTGCTGGGG - Intergenic
1124483476 15:30097385-30097407 GGCGAGGGCACGGGCTGCTGGGG + Intergenic
1124489927 15:30149447-30149469 GGCGAGGGCACGGGCTGCTGGGG + Intergenic
1124520102 15:30399841-30399863 GGCGAGGGCACGGGCTGCTGGGG - Intergenic
1124538553 15:30566383-30566405 GGCGAGGGCACGGGCTGCTGGGG + Intergenic
1124753605 15:32388880-32388902 GGCGAGGGCACGGGCTGCTGGGG - Intergenic
1124760098 15:32441199-32441221 GGCGAGGGCACGGGCTGCTGGGG - Intergenic
1124975346 15:34524582-34524604 GGCGAGGGCACGGGCTGCTGGGG - Intergenic
1125300769 15:38252251-38252273 GGTTCGGGCAGCGGCTGCGGCGG + Intergenic
1125485599 15:40108795-40108817 GGCGCAGGCAGGGGCGGCGGCGG + Exonic
1125524679 15:40367536-40367558 GCCTCAAGCAGGAGCTGCTGAGG + Exonic
1125879984 15:43185444-43185466 GGCTCCGGCAGTGGCAGCGGAGG + Exonic
1127547458 15:60004370-60004392 GGCTCCGGAGGGCGCTGCTGTGG - Exonic
1127606519 15:60592504-60592526 AGCTGCGGCAGCTGCTGCTGTGG - Intronic
1127994873 15:64147545-64147567 GGCCCCCGGCGGGGCTGCTGCGG + Intergenic
1128067743 15:64775249-64775271 GGCTCCGGCGCGGGCTCCGGCGG - Exonic
1128087723 15:64897430-64897452 GCCTTCTGCAGGGGCAGCTGAGG - Intronic
1128759786 15:70208623-70208645 GGTTCAGCCAGGGGCAGCTGTGG - Intergenic
1128850886 15:70954850-70954872 TGCTCCAGCAGGGGCAGCAGGGG + Intronic
1129154131 15:73707201-73707223 GCCTCCTGCAGAAGCTGCTGAGG + Intronic
1129605583 15:77023434-77023456 TGGTGCGGCAGGGGCTGCAGCGG + Intronic
1129727963 15:77911233-77911255 GGCGAGGGCATGGGCTGCTGTGG - Intergenic
1129893796 15:79089547-79089569 GGCTAGGGCCAGGGCTGCTGCGG - Intronic
1130166510 15:81466351-81466373 GGATCCAGCAGGTGCTGCTGGGG - Intergenic
1130282352 15:82530263-82530285 GGCAAGGGCATGGGCTGCTGGGG + Intergenic
1130926872 15:88392089-88392111 GGCACCAGGAGGGGCAGCTGAGG - Intergenic
1131094140 15:89645480-89645502 GGCTGGGGCAGGGGCTGGGGAGG - Intronic
1131367841 15:91854322-91854344 GGCTGGGGCAGGGGGTGCCGGGG + Intronic
1131827147 15:96331070-96331092 GGCTCCGGCGGCGGCAGCAGCGG + Exonic
1132092769 15:98959340-98959362 TGGTCCGGCAGGGCCTGTTGTGG + Exonic
1132400027 15:101499406-101499428 GGCTCTGGGAGAGGCTGCAGTGG - Intronic
1132485768 16:190017-190039 GGCTCCGGGAACGGCTGCGGTGG + Exonic
1132549671 16:549171-549193 ACATCCTGCAGGGGCTGCTGGGG + Exonic
1132551530 16:555728-555750 GGCCACGTGAGGGGCTGCTGCGG + Intergenic
1132569342 16:637254-637276 GGTTGCGGCAGGGGCGGCAGGGG + Intronic
1132687494 16:1168452-1168474 GGCTCCTGCTTGGGCTGCTCTGG + Intronic
1132744766 16:1432039-1432061 GTCCCGGGCTGGGGCTGCTGTGG - Intergenic
1132771764 16:1567472-1567494 AGCTCCGGCCAGGCCTGCTGAGG - Intronic
1132915330 16:2340750-2340772 GGCTCCTGCAGGGGGCGCCGCGG + Intergenic
1133013393 16:2927344-2927366 GGCTCCAGCAGGAGCACCTGCGG + Intronic
1133020477 16:2964740-2964762 GGCTCCTGCAGGGGCGGGTGCGG + Intronic
1133133299 16:3691605-3691627 GGCTTCTGCAGGGGCTGCGAGGG - Intronic
1133221232 16:4319990-4320012 TCCCCCAGCAGGGGCTGCTGGGG - Intronic
1133222529 16:4324953-4324975 GGCAGGGGCAGGGCCTGCTGGGG - Intronic
1133370016 16:5239987-5240009 GGCTGCGGCTGGGGCTGGAGGGG + Intergenic
1133879053 16:9763613-9763635 TGCTCCGGGAGGGCCTGCTAAGG + Exonic
1135377163 16:21957272-21957294 TGCTCCTGCAGGCGCAGCTGTGG - Exonic
1135407792 16:22210493-22210515 GGCTGCTGCAGTGGCTGCTGCGG + Intronic
1135424076 16:22323735-22323757 GGGGCGGGCAGGGGCAGCTGGGG - Intronic
1135694072 16:24572142-24572164 GGCTGACGCTGGGGCTGCTGTGG - Exonic
1136069877 16:27781321-27781343 GGCTCTGGCAGGGGCTGGAGAGG - Intergenic
1136683659 16:31981967-31981989 GGCGGCGGCGGGGGCTGCGGCGG + Intergenic
1136757298 16:32695438-32695460 GGCAGGGGCAGAGGCTGCTGAGG + Intergenic
1136810809 16:33174937-33174959 GGCAGGGGCAGAGGCTGCTGAGG - Intergenic
1136817285 16:33285017-33285039 GGCAGGGGCAGAGGCTGCTGAGG - Intronic
1136823848 16:33341546-33341568 GGCAGGGGCAGAGGCTGCTGAGG - Intergenic
1137268124 16:46885011-46885033 GACCCCAGCTGGGGCTGCTGCGG - Intronic
1137668622 16:50266501-50266523 TGCTCCGGCAGCGGCAGCAGCGG - Exonic
1138360771 16:56425510-56425532 CGCGCCGGCAGGGGCAGCAGCGG - Exonic
1138478130 16:57284077-57284099 GGCTCCGGTGGGGGCTTCTGTGG + Intronic
1138686945 16:58734142-58734164 GGCTCTGGCAGAGGCCGCGGCGG + Exonic
1139492132 16:67291804-67291826 GCCTCGGGCAGAGGCTGCTCAGG + Exonic
1139517257 16:67459367-67459389 GGCTCCAGCAGGGGCAGCTGAGG + Intronic
1139955868 16:70692726-70692748 GGCCTTGCCAGGGGCTGCTGAGG - Intronic
1140477584 16:75246746-75246768 GGTTCCGGGGGAGGCTGCTGGGG - Intronic
1140480846 16:75262133-75262155 GGTTCCTGGAGAGGCTGCTGCGG - Intronic
1140726804 16:77820914-77820936 TGCTAGGGCAGGGACTGCTGGGG - Intronic
1141277615 16:82602684-82602706 GGCTCAGGCTGTGGCTGCTCGGG - Intergenic
1141618818 16:85225575-85225597 AGCTGCTGCAGGGGCTGGTGCGG + Intergenic
1141695853 16:85619090-85619112 GGGGCCGGCAGGGTCTGCTGTGG - Intronic
1141699277 16:85635049-85635071 GGCTCCTGCATGTGTTGCTGTGG - Intronic
1141881990 16:86866387-86866409 GGCTCCCGCAGGGGAGGCTCTGG + Intergenic
1142153362 16:88522359-88522381 GGCTGAGGCTGAGGCTGCTGAGG - Intronic
1142262919 16:89050994-89051016 AGCCCCGGGAGGCGCTGCTGTGG - Intergenic
1142415025 16:89936563-89936585 GGCCCTGGGAGGGGCTGCTGAGG + Intergenic
1142496754 17:310092-310114 GGCTCAGGCGGGCTCTGCTGTGG + Intronic
1142643669 17:1299168-1299190 GGCTCCGTCTGGTGCTGCTTAGG + Exonic
1142685377 17:1574608-1574630 CCCGCCGGCAGGGGGTGCTGTGG + Exonic
1142694816 17:1627975-1627997 GGCAGCGGTCGGGGCTGCTGGGG - Intronic
1142711900 17:1728028-1728050 GGACCTGGCAGGGGCTGCTGAGG + Exonic
1142743564 17:1943738-1943760 GGCTCCAGGCGGGGCTGCAGAGG - Intronic
1142762645 17:2050932-2050954 GGCGCCGGCAGGTGCTGCGCGGG + Intergenic
1143103393 17:4515963-4515985 GGCTCCTGCAGGGGGTCCAGGGG - Intronic
1143319167 17:6056777-6056799 GACTCTGGCAGGGGCAGCGGGGG + Intronic
1143400759 17:6640611-6640633 GGCTCGGGCCGGGGCTGGGGGGG - Intronic
1143617809 17:8064150-8064172 GGGTCCAGCTGAGGCTGCTGGGG + Intergenic
1143631393 17:8142381-8142403 GGCTGAGGCTGGGGCTGCTCGGG - Exonic
1143632005 17:8144905-8144927 GGCTGGGTCAGGGGCTACTGTGG + Exonic
1143697513 17:8631004-8631026 GGCTCCGGGAGGTGCGGCCGGGG + Intergenic
1144494877 17:15739738-15739760 CGCTCTGGGAGGGGCTGCAGTGG + Intronic
1144622039 17:16823977-16823999 GCCTCCAGCAGGGGCTGTTGGGG - Intergenic
1144675872 17:17161286-17161308 GGCTCCTGCAGGACCAGCTGAGG + Exonic
1144777784 17:17793483-17793505 GGGTATGCCAGGGGCTGCTGGGG - Exonic
1144846979 17:18225341-18225363 GGCTCCAGCGCGGGCGGCTGGGG - Intergenic
1144854975 17:18262644-18262666 GGCTGGGAGAGGGGCTGCTGTGG - Intronic
1144884385 17:18448737-18448759 GCCTCCAGCAGGGGCTGTTGGGG + Intergenic
1144905378 17:18636934-18636956 CGCTCTGGGAGGGGCTGCAGTGG - Intronic
1145147846 17:20495640-20495662 GCCTCCAGCAGGGGCTGTTGGGG - Intergenic
1145954138 17:28842853-28842875 GCCCCCGGCAGGGGCTGCGCAGG - Intronic
1147123891 17:38352503-38352525 GGCTGCGGAGGGGGCGGCTGAGG - Exonic
1147144578 17:38477674-38477696 GGCGGCGGCGGGGGCTGCGGCGG + Exonic
1147183652 17:38702363-38702385 GGCTCCGGCGGCGGCCGCGGCGG + Intergenic
1147306877 17:39570189-39570211 AGCTCCTTCAGGGGCTGGTGTGG + Intergenic
1147535049 17:41315421-41315443 GGCTGCGGGGGTGGCTGCTGTGG - Exonic
1147574007 17:41588311-41588333 GCCTCCAGCAGGGGCTGTTGGGG - Intergenic
1147620789 17:41865343-41865365 GGCTGCGGCAGTGGCGGCGGCGG - Exonic
1148124751 17:45230939-45230961 GGTTCAGGCTGGGGCAGCTGGGG + Intronic
1148153522 17:45410216-45410238 GGCACAGGTAGGGGATGCTGGGG - Intronic
1150249400 17:63697895-63697917 GGCACTGGCAGGGGCTGGTGCGG - Exonic
1151666692 17:75549414-75549436 GGCCCAGGCAGGTGCTTCTGCGG - Intronic
1151723228 17:75870024-75870046 GGCTCTGGCGGGAGCTTCTGAGG + Intergenic
1151907162 17:77056180-77056202 AGCCCCGGCTTGGGCTGCTGAGG - Intergenic
1152072157 17:78139218-78139240 GGCTCCGGAAGCAGCTGGTGTGG + Exonic
1152558275 17:81065416-81065438 GGCACCACCAGGGGCTGGTGTGG + Intronic
1152795177 17:82303020-82303042 GAGGCCGTCAGGGGCTGCTGGGG + Intergenic
1152806042 17:82356826-82356848 GGCTCCGTCCCAGGCTGCTGAGG + Intergenic
1153721036 18:7903363-7903385 GGCTACTGCAGGGACAGCTGAGG - Intronic
1154018108 18:10638105-10638127 GGCTGAGGCAGGGCCAGCTGAGG - Intergenic
1154186763 18:12191477-12191499 GGCTGAGGCAGGGCCAGCTGAGG + Intergenic
1154325359 18:13387200-13387222 GGCTCCCACAGGGGCTGCCAGGG - Intronic
1154374903 18:13801046-13801068 GGCCCCGGCAGGCGATGCGGAGG + Intergenic
1155152786 18:23135856-23135878 GGCTGAGGCTGGGGCTGCGGCGG - Exonic
1156112269 18:33743055-33743077 GGCTGCTGCAGCTGCTGCTGTGG + Exonic
1156702471 18:39841819-39841841 GGCATCGGCAGGGTCTCCTGCGG - Intergenic
1157306949 18:46524565-46524587 GGCTGCTGCAGTTGCTGCTGCGG + Exonic
1157493725 18:48140879-48140901 GGCTCCGCCAAGGGCAGCAGTGG - Intronic
1157867205 18:51197244-51197266 GGCGGCGGCGGGGGCGGCTGCGG + Exonic
1157880059 18:51313031-51313053 GGCTCAGGCAGGAGCTGCTGCGG - Intergenic
1158357500 18:56638004-56638026 GGCTCAGGCAAGGGTGGCTGCGG + Intronic
1158976504 18:62715749-62715771 GGCTCCGGCGGCCGCCGCTGCGG + Exonic
1160497458 18:79383707-79383729 GGCTCTGGGAAGGGCTGCAGGGG - Intergenic
1160703470 19:518640-518662 GGCCCGGGCTGGGGATGCTGCGG + Intronic
1160810074 19:1009457-1009479 GGCTCCGCCAGGCCCTGGTGCGG + Exonic
1160854096 19:1208187-1208209 GGTCCGGGGAGGGGCTGCTGCGG + Intronic
1160875830 19:1295866-1295888 GGGTCGGGCCGGGGCTGCCGGGG + Intronic
1160894290 19:1395491-1395513 GGCTCCGGCGGCGGCGGCGGCGG - Exonic
1160906072 19:1452249-1452271 GGATGGGGCAGGGGCTGCCGGGG + Exonic
1161210294 19:3062241-3062263 CGCCCCGGCTCGGGCTGCTGGGG + Intronic
1161461529 19:4400445-4400467 GGCGCCGACGGGGACTGCTGAGG - Exonic
1161485712 19:4534748-4534770 GGCCCAGGCAGGGGCCGCAGGGG - Intronic
1161581217 19:5082092-5082114 GGGCAGGGCAGGGGCTGCTGGGG + Intronic
1161587949 19:5115509-5115531 GGCAGTGGCAGGGGCTGCTGAGG - Intronic
1161594217 19:5142932-5142954 GGCTCGGGCAGGTGTTGCAGCGG + Intronic
1161734619 19:5983873-5983895 GGCTGCCGCAGGAGCTGTTGGGG - Intergenic
1161800460 19:6414612-6414634 GGCTCTGGCAGGGACTGGTGGGG - Intronic
1161986582 19:7658295-7658317 GGCTCTGGCATGACCTGCTGGGG - Intergenic
1162013279 19:7830581-7830603 GGATCCTGCAGGAGCTCCTGGGG - Intronic
1162327460 19:10007506-10007528 GGCTTGGGCAGGGGCGGGTGGGG + Intronic
1162806632 19:13140644-13140666 GGGTCGGGCAGGGGGTGCAGGGG + Exonic
1163035591 19:14567190-14567212 GGATCCGGCACGGGATGTTGAGG - Intronic
1163125502 19:15242277-15242299 GGCTCCGGCAGGGGATGTTCTGG - Intronic
1163138797 19:15332434-15332456 GGCGGCGGCAGCGGCTGCGGCGG - Intronic
1163441299 19:17323828-17323850 GGCTCCGGCTGCGGCGGGTGCGG + Exonic
1163582638 19:18147581-18147603 GGCTTCGGCAGGGAGTGGTGGGG - Exonic
1163793387 19:19321270-19321292 GGGTCCGGCAGAGGCGGGTGGGG - Intronic
1163830948 19:19546944-19546966 GGCCCAGGGTGGGGCTGCTGTGG - Intergenic
1163851051 19:19663792-19663814 GGCCCCGGCAGGGACTACTTCGG + Intergenic
1164594848 19:29526114-29526136 GGAACCGGCGGGGGCGGCTGCGG + Intergenic
1164621751 19:29700119-29700141 GGCTGTGGGAGGGGCTGCAGTGG + Intronic
1164785382 19:30926419-30926441 GGCTCTGGCAGGACATGCTGGGG - Intergenic
1165224123 19:34342161-34342183 GGCTGGGGCGGGGGCTGCTGCGG - Exonic
1165724775 19:38104994-38105016 GGCTCTGGCACTGGCAGCTGTGG + Intronic
1165811164 19:38612717-38612739 GGCTCCGGAAGTGGCAGCTGTGG - Exonic
1166055421 19:40285281-40285303 GGCGCCGGCAGCGGCAGCGGCGG + Exonic
1166725546 19:45025238-45025260 GGCTCTGGCAGATGCTGCTGTGG - Intronic
1166770398 19:45278347-45278369 GGCTCCGGCAGGGGACGTGGGGG + Intronic
1166888039 19:45973398-45973420 GGCGGCGGCGGCGGCTGCTGTGG + Exonic
1167053757 19:47095952-47095974 GGCTCCCGCTTGGGCAGCTGCGG - Intronic
1167079896 19:47271499-47271521 GGCTCCAGCAGGGGCTCCTCCGG - Exonic
1167578939 19:50330901-50330923 GGCTGCGGCTGGGGCTGCGGAGG + Intronic
1167584992 19:50369200-50369222 GGGTTGGGGAGGGGCTGCTGCGG + Intronic
1167597374 19:50434887-50434909 GGATGGGGCAGGGCCTGCTGGGG + Intronic
1168312000 19:55465113-55465135 GGCTCCCAAAGGGGCTGGTGCGG + Intergenic
1168339127 19:55613811-55613833 GGCTGCGGCGGGGGCTGCGGCGG - Exonic
1202712349 1_KI270714v1_random:25343-25365 GCCTCGGGCAGGGGCGGCGGCGG + Intergenic
925025007 2:600738-600760 GGCTCTGGCAGCGGCCTCTGTGG - Intergenic
925203991 2:1991258-1991280 GGCGGCGGCAGGGGCTGATGTGG - Intronic
925750792 2:7089434-7089456 GGCTCCAGCGGGAGCCGCTGTGG - Intergenic
926131013 2:10303108-10303130 GGCGCCGGCGGCGGCTGCAGCGG - Intronic
928207383 2:29295808-29295830 GTCTCAGGCAGAGGCTGCTGTGG + Intronic
928606359 2:32947625-32947647 GGCTCCGGCGGCGGCGGCGGCGG - Exonic
930136105 2:47905602-47905624 GGCTGCTGCTGGGGCGGCTGCGG + Exonic
930136108 2:47905617-47905639 GGCTGCGGCGGCGGCTGCTGCGG + Exonic
930155937 2:48107696-48107718 GGCTGCAGCAGGGGCTGAGGTGG - Intergenic
930237297 2:48900396-48900418 GGCACCTGCTGGGGCTGCTGGGG + Intergenic
931668189 2:64625002-64625024 GGCATGGGCAGGGGCTGCTTGGG - Intergenic
932356578 2:71072697-71072719 GGCTCCGAGAGTGGCTGCGGCGG + Exonic
933411021 2:81925156-81925178 AGCTACTGCAGGGGGTGCTGAGG + Intergenic
933764699 2:85698632-85698654 GGAGCCGGCAGAGGTTGCTGAGG - Exonic
934056406 2:88254730-88254752 GGCACCGGCAGGGCCAGCAGTGG - Intergenic
934113757 2:88765384-88765406 GGCTCCGGCTGGGGCTGGCGGGG - Intergenic
934636269 2:95992287-95992309 GGCTCCGGCGGGGGCTGGCGGGG + Intergenic
934797378 2:97113139-97113161 GGCTCCGGCGGGGGCTGGCGGGG - Intergenic
934836031 2:97590300-97590322 GGCTCCGGCGGGGGCTGGCGGGG + Intergenic
935318365 2:101860302-101860324 GGCTGCGGCAGGGACTGCTCGGG + Intronic
935592893 2:104857074-104857096 GGCGGCGGCAGGGGCGGCGGCGG - Exonic
935620343 2:105124729-105124751 GGCTCCAGCAGCGCCTGCTTGGG + Intergenic
935811070 2:106797679-106797701 GGCTCATGCAGAGGCTGCAGTGG + Intergenic
937096856 2:119241293-119241315 GGCTGTGGGTGGGGCTGCTGGGG - Intronic
937262919 2:120597896-120597918 GGCCCAGGCAGAGGCTGCAGAGG + Intergenic
937905697 2:127051789-127051811 GGTTCCTGCAGGGCCTGCCGTGG - Intronic
937912259 2:127081427-127081449 GACCCCAGGAGGGGCTGCTGGGG - Intronic
938271856 2:129979679-129979701 GGCTGCGGCGGCGGCGGCTGGGG + Exonic
938291891 2:130154964-130154986 GGCCCCGGCAAAGGGTGCTGTGG - Intronic
938379113 2:130826789-130826811 GGCTGCGGCAGGAGCTGCAGTGG - Intergenic
938444145 2:131364121-131364143 GGCTGCGGCGGCGGCGGCTGGGG - Intergenic
938464659 2:131518000-131518022 GGCCCCGGCAAAGGGTGCTGTGG + Intergenic
939629431 2:144516003-144516025 GGCGCGGGCTGGGGCTGCGGAGG + Intronic
940796803 2:158089146-158089168 GGGTCTTGCAGTGGCTGCTGGGG + Intronic
940915621 2:159251969-159251991 GCCTCCAGCTGGGGCTGCTGTGG - Intronic
942046702 2:172103047-172103069 GGCTGCGGCTGCGGCTGCAGCGG + Intergenic
942361289 2:175174516-175174538 GGCTGCGGCAGGGTCACCTGAGG + Intergenic
942446173 2:176080314-176080336 GGCTGCGGCAGCTGCTGCCGCGG + Exonic
942447520 2:176088019-176088041 GGCTCCGGCAGCGGCAGACGCGG - Intergenic
942448395 2:176093064-176093086 GGCGGCGGCAGCGGCGGCTGCGG + Exonic
942450918 2:176107629-176107651 GGCCCCGGCGGGGGCGGCGGCGG + Exonic
942946496 2:181679834-181679856 GGCTCCAGTAGTGGCTGCTGGGG + Intronic
944274364 2:197818924-197818946 GGCTGGGACAGGGGCTGGTGAGG + Intronic
946354875 2:219178326-219178348 GGCTCGGGCGGCGGCTGCGGCGG + Exonic
947860570 2:233354716-233354738 GGCCTCGGCCGGGGCTGCCGCGG - Intronic
948386562 2:237584356-237584378 GGCTCCTGCAGGCTCTGCTAGGG + Intronic
948389760 2:237603567-237603589 GGCTCCTGCACGTGCTGGTGAGG - Intergenic
948641976 2:239380933-239380955 GCATCCGGGAGGCGCTGCTGAGG - Intronic
948852521 2:240715406-240715428 GGCTCTCCCAGGGGCTGATGGGG - Exonic
1169163903 20:3406849-3406871 GGCTGAGGCAGGGGGAGCTGGGG + Intronic
1169227244 20:3864413-3864435 GGCCTCTGCAGGGGCTGCAGAGG + Exonic
1169506028 20:6212970-6212992 CGCTCTGGCAGCGGCTGCGGAGG - Intergenic
1170130486 20:13013843-13013865 GATTCAGGCAGGGGCTGCTAGGG + Intronic
1170131611 20:13026704-13026726 GGCACCAGCAGGGTCTGCTATGG - Intronic
1171201506 20:23245817-23245839 TGCTCCAGCAGGGGCCGCTGTGG - Intergenic
1171293001 20:23993419-23993441 GCCTGTGGGAGGGGCTGCTGAGG + Intergenic
1171388305 20:24785280-24785302 GGCTCTGGCAGTGACTGCCGGGG + Intergenic
1172127599 20:32634171-32634193 GGCGCAGGCACGGGCTGCTGGGG + Intergenic
1172224682 20:33297451-33297473 GGCACAGCCCGGGGCTGCTGTGG + Intronic
1174053898 20:47785383-47785405 GGCTGCGGCAGAGGCGGCGGCGG - Intronic
1174258804 20:49278282-49278304 GGCTCAGGCGGGCGCGGCTGAGG + Intronic
1175137403 20:56834691-56834713 GGCTCCAGCTGGGCCTGTTGCGG + Intergenic
1175267231 20:57710098-57710120 GGCTCGGGGAGGGGGTGCGGGGG - Intronic
1175273728 20:57753449-57753471 GCCTCCTGCAGGGCCTGGTGCGG + Intergenic
1175777663 20:61663341-61663363 CGCTGGGGCAGGGGCTGCTGCGG + Intronic
1175908038 20:62391486-62391508 GGCTCTGGCTGGGGCTGAGGAGG + Intronic
1175914280 20:62418569-62418591 GGCTCCCCCAGGGGGTGCAGGGG - Intronic
1175919576 20:62444380-62444402 GTCTCAGGCTGGGGCGGCTGGGG + Intergenic
1176043579 20:63081012-63081034 AGCTGCTGAAGGGGCTGCTGTGG + Intergenic
1176061580 20:63175071-63175093 GGCTCCGGCGGGGGCGGGAGCGG - Intergenic
1176069541 20:63218884-63218906 GGCACCAGCAGGGGGTGCTGAGG + Intergenic
1176141945 20:63548696-63548718 AGGTGCGGAAGGGGCTGCTGGGG - Intronic
1176159481 20:63641141-63641163 GGCTCCTGCAGGGGAAGCCGTGG + Exonic
1176173586 20:63707535-63707557 GGCGCCTGCAGGGGCTCCTGGGG - Intronic
1176218155 20:63957857-63957879 GGGTCTGGCAGCTGCTGCTGGGG - Exonic
1176232103 20:64037952-64037974 CGCTCCTGCTGGCGCTGCTGGGG + Intronic
1176234660 20:64048764-64048786 GGCTCGGGCGGTGGCTGCGGGGG + Exonic
1176376941 21:6091512-6091534 GGCTCCCGCTGGGCCGGCTGTGG + Intergenic
1176389050 21:6154346-6154368 GGCTCGGGCTGTAGCTGCTGGGG + Intergenic
1176675579 21:9774368-9774390 GGCTCCTGCAGGTGCTGAGGTGG - Intergenic
1178329134 21:31671991-31672013 GGCTGCTGCTGTGGCTGCTGCGG + Exonic
1178429659 21:32508320-32508342 GCCTCTGGCAGGCCCTGCTGTGG + Intronic
1178699371 21:34820179-34820201 GGTGCCGGCTGGGGCTGCGGAGG + Intronic
1179400194 21:41076246-41076268 GGGTCAGGCACGCGCTGCTGTGG - Intergenic
1179734422 21:43383902-43383924 GGCTCGGGCTGTAGCTGCTGGGG - Intergenic
1179746534 21:43446732-43446754 GGCTCCCGCTGGGCCGGCTGTGG - Intergenic
1179878931 21:44285515-44285537 GGCCCTGGCAGGGGCTGCCCAGG - Intergenic
1179902280 21:44400413-44400435 GGCTGCGGGAGAGGCTCCTGGGG + Intronic
1179903446 21:44406855-44406877 GGCTCCATCAGGGGGTCCTGCGG + Intronic
1180043605 21:45292826-45292848 GGCTCCGGGAGGGGCCGCAGAGG - Intergenic
1180824059 22:18851134-18851156 GCCTGTGGGAGGGGCTGCTGAGG + Intronic
1181124485 22:20694288-20694310 GCCTGTGGGAGGGGCTGCTGAGG + Intergenic
1181188679 22:21123414-21123436 GCCTGTGGAAGGGGCTGCTGAGG - Intergenic
1181210520 22:21287079-21287101 GCCTGTGGAAGGGGCTGCTGAGG + Intergenic
1181398990 22:22639812-22639834 GCCTGTGGGAGGGGCTGCTGAGG - Intergenic
1181490384 22:23257627-23257649 GGCACCTGCAGGGGCAGCTGGGG + Intronic
1181501720 22:23319158-23319180 GCCTGTGGGAGGGGCTGCTGAGG - Intergenic
1181649918 22:24253128-24253150 GGAGCGGGGAGGGGCTGCTGCGG - Intergenic
1181650430 22:24256247-24256269 GCCTGTGGGAGGGGCTGCTGAGG + Intergenic
1181706950 22:24654491-24654513 GCCTGTGGGAGGGGCTGCTGAGG - Intergenic
1181778989 22:25179112-25179134 GGCTCCTGCAGGGGAAGCCGTGG + Intronic
1181934532 22:26429342-26429364 GGCTCCGGCTCGGGCTCCCGCGG + Exonic
1182295016 22:29307299-29307321 AGCACCGGCAGGGCCTGCGGAGG + Intronic
1182886765 22:33780422-33780444 CTCTTCGACAGGGGCTGCTGGGG - Intronic
1183264634 22:36817621-36817643 GGGACAGGCAGGAGCTGCTGGGG + Intronic
1183677877 22:39309903-39309925 GGCTCCGGTATGAGCTCCTGAGG - Intergenic
1183702292 22:39457420-39457442 GGCTCCGGCGGCAGCGGCTGCGG - Exonic
1184256275 22:43288872-43288894 AGCGACAGCAGGGGCTGCTGGGG - Intronic
1184294530 22:43515314-43515336 GGCTCAGGCAGGGGCTGCGTGGG + Intergenic
1184347733 22:43923819-43923841 GGCGCCGGGCGGAGCTGCTGCGG + Exonic
1184402229 22:44280808-44280830 GGCTCAGGCAGGGGAGGCTCGGG + Intronic
1184414983 22:44346989-44347011 GGCTGTGGCGGGGGCTGCAGAGG - Intergenic
1184557888 22:45242882-45242904 GGAACAGGCAGGGGGTGCTGTGG - Intergenic
1184648228 22:45907733-45907755 GGCTTCGGCAGGTGCCGGTGTGG + Intergenic
1184765309 22:46569196-46569218 GGCTCCTGCAGAGGCTGGGGAGG + Intergenic
1185065299 22:48629060-48629082 GCCGCCGGCAGGGCCTGCGGAGG - Intronic
1185313769 22:50170321-50170343 GCCTCCGGCGGGGGCGGCGGCGG - Intergenic
1185314252 22:50171880-50171902 TGCTGAGGCAGGGTCTGCTGAGG - Intronic
1203216426 22_KI270731v1_random:8351-8373 GCCTGTGGGAGGGGCTGCTGAGG - Intergenic
1203274200 22_KI270734v1_random:77038-77060 GCCTGTGGGAGGGGCTGCTGAGG + Intergenic
950008352 3:9705252-9705274 GGCCAAGTCAGGGGCTGCTGGGG - Intronic
950316305 3:12004642-12004664 GGCGGCGGCGGCGGCTGCTGGGG - Exonic
950704754 3:14772905-14772927 GGCCCCGGCCCGGGGTGCTGGGG + Exonic
951217778 3:20040639-20040661 GGCGACGGCAGTGGCTGCAGCGG + Exonic
951982075 3:28576368-28576390 GGCTGGGGCTGGGGCGGCTGTGG - Intergenic
952955230 3:38552797-38552819 GGCTAAGGCAGGCACTGCTGTGG - Intronic
953282844 3:41575396-41575418 GGCTCTGACAGGGGCTGAGGAGG + Intronic
953314543 3:41913958-41913980 GTCTCCGGGAGGGGGTGCGGCGG + Intronic
953626835 3:44578920-44578942 GGCTCCTGCAGGACCAGCTGAGG - Intronic
953813960 3:46138332-46138354 AGCACCTGTAGGGGCTGCTGAGG + Intergenic
954689545 3:52388412-52388434 GCCTCCAGCAGGGCTTGCTGTGG - Exonic
957046593 3:75379595-75379617 GCCTCTGGCAGGCCCTGCTGTGG - Intergenic
957048779 3:75396164-75396186 GGCTCCGGCCGGGGCTGGCGGGG + Intergenic
957215729 3:77317662-77317684 GGCTGCTGGGGGGGCTGCTGGGG + Intronic
957215757 3:77317731-77317753 GGCTGCTGGGGGGGCTGCTGGGG + Intronic
957215786 3:77317800-77317822 GGCTGCTGGGGGGGCTGCTGGGG + Intronic
957215811 3:77317856-77317878 GGCTGCTGGGGGGGCTGCTGGGG + Intronic
960035172 3:113094826-113094848 GGCTGCCTCAGGGGCAGCTGTGG + Intergenic
960538015 3:118834423-118834445 GGCTTCTTCAGGGGCTACTGGGG - Intergenic
961216407 3:125163864-125163886 TGCTCCAGGAGGTGCTGCTGAGG + Intronic
961411806 3:126727610-126727632 GGCTCAGGTGAGGGCTGCTGCGG - Intronic
961454656 3:127018019-127018041 GGCTACGGCAGGGCCTGCACTGG - Intronic
961536442 3:127573661-127573683 GGAGGCTGCAGGGGCTGCTGGGG - Exonic
961536873 3:127575913-127575935 GGTTCAGGCTGGGGCAGCTGGGG - Intronic
961819219 3:129566710-129566732 GGCACTGGCTTGGGCTGCTGGGG + Intronic
961878646 3:130043827-130043849 GCCTCTGGCAGGCCCTGCTGTGG - Intergenic
963004900 3:140717903-140717925 GGGTTCAGCAGGGGCTCCTGTGG + Intergenic
963060610 3:141221964-141221986 GGTTCTGGCAGGGGCAGATGTGG - Intergenic
963969723 3:151416321-151416343 TGCTGGGGCTGGGGCTGCTGGGG - Exonic
967084264 3:186079856-186079878 GGCATCTGCAGGGGCTGATGTGG + Exonic
967266908 3:187699213-187699235 GGCTCCGGCACTGGCTCCTGAGG - Intronic
967916717 3:194583891-194583913 GGCTGCGGCGGCGGCTGCGGCGG + Intergenic
968433982 4:575765-575787 GGCGCCGGCAGGCGCTCCCGAGG - Intergenic
968448766 4:665415-665437 GTCTCAGGCAGGGGGTTCTGAGG + Intronic
968523809 4:1046279-1046301 GGCTCGGGGTGGGGGTGCTGGGG - Intergenic
968612301 4:1562840-1562862 TGGTCTGGAAGGGGCTGCTGGGG + Intergenic
968645911 4:1740403-1740425 GGCTCCTGGAGGTGCTACTGTGG + Intronic
968658588 4:1789430-1789452 GCCTAGGGCTGGGGCTGCTGCGG - Intergenic
968687325 4:1970081-1970103 GCCTTGGGCAGGGGCTGCTGAGG + Intronic
968729060 4:2261330-2261352 GGCTCAGCCAGGGTCTGCGGGGG - Intronic
968850576 4:3075018-3075040 GGCGGCGGCGGGGGCGGCTGCGG - Exonic
968958975 4:3733292-3733314 GGCTCCTGCATGGTCTGCAGTGG + Intergenic
968990881 4:3910706-3910728 GCCTCTGGCAGGCCCTGCTGTGG - Intergenic
969184025 4:5462436-5462458 GGGGCCGGCAGGGGCAGCTGCGG + Intronic
969551201 4:7868638-7868660 ATCTCCGGCAGGGGCATCTGAGG + Exonic
969824465 4:9746648-9746670 GCCTCTGGCAGGACCTGCTGTGG + Intergenic
970202889 4:13627514-13627536 GGCTGCGGCTGCGGCTGCGGCGG + Exonic
970394818 4:15655308-15655330 GGCGGCGGCCGCGGCTGCTGAGG - Exonic
972585356 4:40432699-40432721 GGCTGCGGCCGCGGCTGCGGCGG + Exonic
976015095 4:80542899-80542921 TGCTCCAGCAGGGGCAGCAGGGG - Intronic
976765349 4:88592670-88592692 GGCTCCCGGAGGGGCGGCTGCGG + Intronic
976774827 4:88697259-88697281 GGCTGCGGCAGAGGCTGCCGCGG - Exonic
977846532 4:101773704-101773726 GGCTATGGCAGGTGGTGCTGAGG + Intronic
979832065 4:125315785-125315807 GGCGCCGGCAGTGGCCGCTGAGG - Intergenic
981315628 4:143337151-143337173 GGCTCCGGGCCGGGCAGCTGAGG - Exonic
982584818 4:157222619-157222641 GGCTCCAGCAGAGGCAGCCGGGG + Intronic
985073669 4:186191831-186191853 GGCTCTGGCTGGGGCTCGTGTGG + Exonic
985541906 5:491342-491364 GGCTCCGGCTGTGGCTGCAGCGG + Intronic
985611360 5:891437-891459 GACCCTGGCAGGGTCTGCTGAGG + Intronic
985844877 5:2336618-2336640 GCCTCCTGCCGAGGCTGCTGTGG - Intergenic
986027509 5:3864727-3864749 CACTCAGGGAGGGGCTGCTGCGG + Intergenic
986329402 5:6706519-6706541 TGCTCAGGCAGTGGCTCCTGCGG + Intergenic
986858796 5:11903691-11903713 GGCGGCGGCGGCGGCTGCTGCGG - Intronic
988264112 5:28928053-28928075 GGCTCCGGCGGGGGCTGGCGGGG + Intergenic
988497553 5:31758029-31758051 GGCCTGGGCAGGGACTGCTGTGG - Intronic
988564889 5:32312888-32312910 GGCTCCAGCTGGGGCAGCAGCGG + Exonic
989523197 5:42424388-42424410 GGCTGCGGCAGGAACTGCCGAGG + Intronic
989591957 5:43120897-43120919 GGCCCCGGCAGCGGCAGCTACGG - Intronic
989656785 5:43753508-43753530 GGCTCAGGCAGTGGCTTCAGTGG - Intergenic
991324430 5:65415425-65415447 GGCTTCGGCAGTGGCATCTGAGG + Intronic
991815897 5:70509994-70510016 GGATGGGGGAGGGGCTGCTGCGG - Intergenic
992641532 5:78772432-78772454 GGGGCTGGGAGGGGCTGCTGGGG + Intergenic
992940075 5:81751957-81751979 GGTTGGGGCAGGGGCCGCTGCGG - Intergenic
995724568 5:115169881-115169903 GGCTGCAGCAGCGGCTCCTGCGG + Intronic
996142744 5:119932718-119932740 GGCTCCAGCTAAGGCTGCTGTGG + Intergenic
997235941 5:132271920-132271942 GGGTCCGGGAGGGGCAGCGGGGG - Intronic
998200471 5:140114266-140114288 GGCTCCGGCGGGGGCGGTGGTGG + Exonic
998250638 5:140549836-140549858 GGATAGGGGAGGGGCTGCTGGGG - Intronic
999243922 5:150143446-150143468 GGCTCGGGGTGGGGGTGCTGGGG + Intronic
999868629 5:155728282-155728304 GGCTCCGGCAGCGGCAGCAGCGG - Intergenic
1001035203 5:168292162-168292184 CCCTCCGGCAGGGGCAGCTCCGG - Exonic
1001065062 5:168529553-168529575 GGCGGCGGCTGGGGCAGCTGGGG + Exonic
1001065108 5:168529670-168529692 GGCTTCGGCGGGGGCGGCCGGGG + Exonic
1002409480 5:179062243-179062265 GGCTTAGCAAGGGGCTGCTGAGG + Intronic
1002599950 5:180348367-180348389 GCCTTGGGCAAGGGCTGCTGAGG + Intronic
1002717101 5:181234500-181234522 CGCTGGAGCAGGGGCTGCTGGGG - Exonic
1002788766 6:423842-423864 GGGTGCGGCGGGGGCTGCAGAGG + Intergenic
1005942457 6:30571030-30571052 GGCTCCGGCAGCTGCTGCTTGGG + Intergenic
1005942534 6:30571500-30571522 GGCTCCGGCGGCTGCTGCTTGGG - Exonic
1005968675 6:30744366-30744388 GCGCCCGGCAGGGGCCGCTGCGG + Exonic
1006468427 6:34210798-34210820 GGCTGAGGCAGGAGCTCCTGAGG - Intergenic
1006633147 6:35443500-35443522 GGCTGGGCCAGGGCCTGCTGGGG + Intergenic
1006898283 6:37484390-37484412 GGGTACGGCAAGGGCTCCTGTGG - Intronic
1007378127 6:41470198-41470220 ACCTCCGGCTGGGGCTGTTGAGG - Intergenic
1007419792 6:41712643-41712665 AGCACTGGCAGGGGCTGCTGAGG + Intronic
1007665293 6:43509938-43509960 GGCTGCGGCGGAGGCTGCGGCGG + Exonic
1007779842 6:44246511-44246533 GGCGCCGGCCGGGGCTGGCGGGG - Intronic
1010414894 6:75601883-75601905 GGCGGCGGCTGGAGCTGCTGTGG + Intronic
1010465812 6:76165991-76166013 AGCCCAGGCAGGGGTTGCTGGGG - Intergenic
1012401172 6:98843757-98843779 GGCAGCAGCAGGGGCTCCTGCGG + Intergenic
1013806377 6:114000348-114000370 GCCTCATGCAGGGGTTGCTGTGG - Intronic
1015029725 6:128580416-128580438 GGCTGCGGGAGGAGCGGCTGCGG - Intergenic
1015974321 6:138773827-138773849 GGCTGCGGCGGTGGCTTCTGAGG + Exonic
1017671911 6:156777537-156777559 CGCTCCGGCGGGGCCTGCGGAGG + Intergenic
1018109361 6:160520339-160520361 GGCACCGGGAGGGGATGCGGGGG + Intergenic
1018754445 6:166837313-166837335 GGCCCAGGGAAGGGCTGCTGAGG - Intronic
1019192721 6:170262535-170262557 GACTCCGGCAGGGCCTCGTGCGG - Intergenic
1019539014 7:1543288-1543310 GGCTCCGGGTGGGGCAGATGGGG - Exonic
1019558774 7:1645582-1645604 GGGGCAGGCAGGGGCTGCAGGGG + Intergenic
1019693967 7:2434166-2434188 GGCGCCGGGAGGGGATGCTGAGG + Exonic
1019714182 7:2530742-2530764 GGGTCTGGGAGGGGCTGCTAGGG + Intergenic
1019987507 7:4668475-4668497 GGCTCTGCCATGGGGTGCTGTGG - Intergenic
1020130262 7:5555451-5555473 GGGACCGGCGGGGGGTGCTGTGG - Intronic
1020313701 7:6888812-6888834 GCCTCTGGCAGGCCCTGCTGTGG - Intergenic
1020832593 7:13110283-13110305 GGCAGGGGCAGGGGGTGCTGAGG - Intergenic
1021160896 7:17271677-17271699 GGCTGTGGCAGGGGCTACTGAGG + Intergenic
1022106292 7:27199936-27199958 GGCTGCAGCAGCGGCTGCAGCGG - Exonic
1022739724 7:33109413-33109435 GGCTCCGGCGGCGGCGGCGGCGG + Intergenic
1023856154 7:44185565-44185587 GGCTCACGCTGGGGCTTCTGTGG + Intronic
1024570830 7:50721858-50721880 GGGTGTGGCAGGGACTGCTGTGG + Intronic
1025145404 7:56496780-56496802 GGGCCAGGCAGGGGCTGCTGAGG + Intergenic
1025188105 7:56876583-56876605 AGCCCGGGCAGGGGCAGCTGGGG + Intergenic
1025683818 7:63700339-63700361 AGCCCGGGCAGGGGCAGCTGGGG - Intergenic
1025738318 7:64174489-64174511 GGGCCAGGCAGGGGCTGCTCAGG + Intronic
1026833477 7:73623749-73623771 GGCTTGGGCCGGGGCTGCTGGGG + Intronic
1026906038 7:74063319-74063341 GGCTGCGGCAGCGGCGGCGGCGG - Exonic
1028871189 7:95772882-95772904 GGGTCCGGCTGCGGCTGCAGGGG - Intronic
1029286372 7:99468689-99468711 GGCTGGGGCAGGGGAAGCTGAGG + Intergenic
1029422173 7:100477446-100477468 GGCTCTGGGGGGCGCTGCTGGGG + Exonic
1029839211 7:103344504-103344526 GACTGAGGCAGGGGCAGCTGAGG + Intronic
1031918632 7:127585496-127585518 GGGGCCGGCCCGGGCTGCTGTGG - Exonic
1032306229 7:130734181-130734203 GGCGGCGGCAGCGGCGGCTGCGG - Intergenic
1032369072 7:131328088-131328110 GGCCCAGGCGGGGCCTGCTGAGG + Intronic
1034100581 7:148446429-148446451 GGCTCGAGCAGAGTCTGCTGTGG + Intergenic
1034530925 7:151696100-151696122 AGCCCTGGCAGGGGCTGCAGAGG - Intronic
1034908074 7:154968471-154968493 TGCTGCTGCGGGGGCTGCTGAGG + Exonic
1034963062 7:155374279-155374301 GGCTCCGGCGGGGGCTGGGCCGG + Intergenic
1035177184 7:157059792-157059814 AGCTCAGGCAGGTGCTGATGAGG - Intergenic
1035218716 7:157391478-157391500 GCCTCCTGCGGTGGCTGCTGGGG + Intronic
1035228190 7:157445008-157445030 AGCTCAGGCAGCGGCAGCTGGGG + Intergenic
1035326360 7:158068407-158068429 AGCTGGGGCAGGAGCTGCTGAGG + Intronic
1035395814 7:158534118-158534140 GGCTCCGTCAGGGATGGCTGTGG + Intronic
1035395829 7:158534168-158534190 GGCTCCGTCAGGGATGGCTGTGG + Intronic
1035395861 7:158534268-158534290 GGCTCCGTCAGGGATGGCTGTGG + Intronic
1035395876 7:158534318-158534340 GGCTCCGTCAGGGATGGCTGTGG + Intronic
1035395891 7:158534368-158534390 GGCTCCGTCAGGGATGGCTGTGG + Intronic
1035636207 8:1146165-1146187 AGCACCTGCAGGGGCTCCTGTGG - Intergenic
1035747112 8:1970245-1970267 GGCTCTCCCAGGGGCTGCAGGGG - Intergenic
1036398240 8:8386528-8386550 GGCGGCGGCAGGGACTGCGGAGG - Intergenic
1037674331 8:21041162-21041184 GCCTCCTGCAGGGGCTGAAGTGG - Intergenic
1037876554 8:22551625-22551647 GGCGCCGGGAGGGGCCGCCGAGG - Intronic
1037880022 8:22568689-22568711 GGCTCCGGCTGGGGTAGATGGGG + Intronic
1039549123 8:38430427-38430449 GACTTGGGCAGGGGCTGCTGGGG - Intronic
1039926054 8:41933232-41933254 GGCGGCGGCTGTGGCTGCTGTGG + Exonic
1040478616 8:47803363-47803385 GGCTCCGGCAGTGGCTCAGGCGG + Exonic
1041552413 8:59118036-59118058 GGCGCTGGCCTGGGCTGCTGCGG - Intronic
1041637101 8:60156502-60156524 GGGTCCTGCTGTGGCTGCTGTGG - Intergenic
1045169976 8:99654673-99654695 GCCTCTGGCAGAGGCTGCTTGGG + Intronic
1047390977 8:124451126-124451148 AGCTCCTGCAGGTGCTGCTCTGG - Exonic
1047615081 8:126557172-126557194 GGCTGCGGCTGGGGCGGCGGCGG + Exonic
1049040875 8:140110957-140110979 AGCTGCTGCAGGGGCTGCAGGGG - Intronic
1049198515 8:141328508-141328530 GGCTGAGGCAGGGGCTGCTGGGG + Intergenic
1049427102 8:142542498-142542520 GGTGGGGGCAGGGGCTGCTGGGG - Exonic
1049435823 8:142585773-142585795 GGCTCGGGAAGGTGCTGCTGTGG - Intergenic
1049444735 8:142624729-142624751 GGGGCCTGCAGAGGCTGCTGAGG - Intergenic
1049568657 8:143357545-143357567 GGCTGAGGCAGGGACTGCTTGGG + Intronic
1049571129 8:143370785-143370807 CCCTCCCGCAGGGGCTGCAGGGG + Intronic
1049655798 8:143796479-143796501 GGCACAGGGAGGGGCTGCTCAGG + Intronic
1049675921 8:143888999-143889021 GTCTCAGGCGGTGGCTGCTGCGG - Intergenic
1049676433 8:143891305-143891327 GGCCCCGGTAGGGGGAGCTGTGG + Intergenic
1049813122 8:144585196-144585218 GGGACCGGCAGAGGCTTCTGGGG - Intronic
1052731457 9:32291224-32291246 GGGTCCTGCTGGGGCTGCTGTGG + Intergenic
1053239938 9:36487400-36487422 GGCTCCGGCCGGGGCGGCGGCGG + Intronic
1054076994 9:60546160-60546182 GGCTCTGGCAGAGGCTGGCGGGG - Intergenic
1055514279 9:77020637-77020659 GACTCCGGCTGCGGCTGCGGCGG - Exonic
1057041039 9:91847531-91847553 GGCTCCTGCAGGGCCTCCTCTGG - Intronic
1057276962 9:93681115-93681137 GGCCCTGGAAGGGGCTTCTGCGG + Intergenic
1057447485 9:95127530-95127552 GGCTCTGACAGGGGCAGGTGCGG + Intronic
1057814400 9:98284022-98284044 TGCACCTGCAGGGGCTGCTGTGG - Intergenic
1058523086 9:105831440-105831462 GGCTCTGGCACAGGCTTCTGGGG + Intergenic
1058897308 9:109411482-109411504 GGCTCCGGAAGGGGCTGGTGTGG - Intronic
1060210998 9:121710329-121710351 GGCTCTGCTGGGGGCTGCTGTGG + Intronic
1061062197 9:128256089-128256111 GGCGAGGGCACGGGCTGCTGGGG - Exonic
1061382313 9:130265847-130265869 GGCTCTGGCTGCGGGTGCTGCGG - Intergenic
1061858374 9:133455484-133455506 GGCACCAGCAGGGGTGGCTGTGG - Exonic
1062016062 9:134291985-134292007 GGCCCAGGCTGAGGCTGCTGGGG + Intergenic
1062045070 9:134421245-134421267 GGCTCCTGGAGGCTCTGCTGGGG + Intronic
1062172474 9:135143053-135143075 GGCTCCGACTGGGGCTGCTGGGG - Intergenic
1062274956 9:135726191-135726213 GGCTGGGGCAGGGGCAGCTGAGG + Intronic
1062310204 9:135931343-135931365 TGCTCCTGCAGCGGCTGCTGGGG - Intergenic
1062400512 9:136370585-136370607 GGCCCAGCCAGGAGCTGCTGTGG - Exonic
1062472507 9:136712639-136712661 GGCTCCGGCCGGGGCTGCGCGGG - Exonic
1185850930 X:3485906-3485928 TCCTCCGGCAGGGGATGCAGAGG + Intergenic
1186799518 X:13078998-13079020 AGCTCATGCAGAGGCTGCTGAGG + Intergenic
1187679043 X:21747866-21747888 GATTCTGGCAGGAGCTGCTGGGG - Intronic
1190040907 X:47071316-47071338 AGATCCTGCAGAGGCTGCTGAGG - Intergenic
1191629930 X:63311796-63311818 GGCTATGGCAGGGGTGGCTGGGG + Intergenic
1191862563 X:65677932-65677954 TGCTCCAGCAGGGCCTGATGTGG + Intronic
1192180545 X:68913119-68913141 GGCTGCGGCTGCGGCGGCTGCGG - Intergenic
1192180546 X:68913125-68913147 GGCTGCGGCTGCGGCTGCGGCGG - Intergenic
1192206290 X:69098644-69098666 GCCTCCTGCATGGGCTGTTGTGG + Intergenic
1192795515 X:74421779-74421801 GGCTCCGGCTGGGGCTCGGGCGG - Exonic
1193502578 X:82297757-82297779 CACTCTGGCAGGGGATGCTGTGG - Intergenic
1194103601 X:89738670-89738692 TCCTTGGGCAGGGGCTGCTGTGG + Intergenic
1194352165 X:92834390-92834412 GGCACCAGCTGGGGCAGCTGAGG + Intergenic
1197226968 X:123963176-123963198 GGCTCTAGCAGGGCCTGCTCGGG + Intronic
1197726786 X:129781804-129781826 GGCTCTGGCAGGGGTTGGGGTGG - Intronic
1197771988 X:130094998-130095020 GTCTCAGGCATGGCCTGCTGGGG + Intronic
1198807157 X:140504020-140504042 GGCGGCGGCCGCGGCTGCTGTGG + Exonic
1199699434 X:150364853-150364875 GGCGCGGGCCGGGGCCGCTGGGG - Intronic
1200100729 X:153688229-153688251 GGCTCGGGCGGCGGCGGCTGCGG - Exonic
1200102555 X:153695250-153695272 GGCTGAAGCAGGGGCTGCTATGG - Exonic
1200137736 X:153883173-153883195 GGGTGAGGCAGGGGCAGCTGGGG + Intronic
1200247015 X:154531776-154531798 GGCTCAGGCAGGGTCTGGAGGGG + Exonic
1200660477 Y:5951128-5951150 GGCACCAGCTGGGGCAGCTGAGG + Intergenic
1200986160 Y:9304874-9304896 TGCTGAGGCAGGGGCCGCTGTGG + Intergenic
1201406082 Y:13651936-13651958 GCGTCCGGCAGGTGCTCCTGTGG - Intergenic
1202124423 Y:21556028-21556050 TGCTGAGGCAGGGGCCGCTGTGG - Intergenic
1202154585 Y:21873352-21873374 TGCTGAGGCAGGGGCCGCTGTGG + Intergenic
1202197272 Y:22308137-22308159 GGCTCCCGCAAGGGCAGCAGTGG - Intergenic