ID: 914993117

View in Genome Browser
Species Human (GRCh38)
Location 1:152515513-152515535
Sequence AGGGGCTGCTGCGGCGACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993099_914993117 21 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993095_914993117 30 Left 914993095 1:152515460-152515482 CCCCGGCGCCCACCCCGGCGCCC 0: 1
1: 2
2: 10
3: 103
4: 902
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993114_914993117 -6 Left 914993114 1:152515496-152515518 CCTGCTGCGGCTCCGGCAGGGGC 0: 1
1: 0
2: 1
3: 62
4: 406
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993100_914993117 18 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993109_914993117 0 Left 914993109 1:152515490-152515512 CCTCCTCCTGCTGCGGCTCCGGC 0: 1
1: 0
2: 9
3: 108
4: 852
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993097_914993117 28 Left 914993097 1:152515462-152515484 CCGGCGCCCACCCCGGCGCCCGC 0: 1
1: 0
2: 14
3: 153
4: 1145
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993096_914993117 29 Left 914993096 1:152515461-152515483 CCCGGCGCCCACCCCGGCGCCCG 0: 1
1: 0
2: 3
3: 76
4: 713
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993103_914993117 10 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993106_914993117 6 Left 914993106 1:152515484-152515506 CCTCCTCCTCCTCCTGCTGCGGC 0: 1
1: 9
2: 70
3: 612
4: 6347
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993101_914993117 17 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993110_914993117 -3 Left 914993110 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 321
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993102_914993117 16 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993098_914993117 22 Left 914993098 1:152515468-152515490 CCCACCCCGGCGCCCGCCTCCTC 0: 1
1: 0
2: 7
3: 61
4: 743
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993104_914993117 9 Left 914993104 1:152515481-152515503 CCGCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226
914993107_914993117 3 Left 914993107 1:152515487-152515509 CCTCCTCCTCCTGCTGCGGCTCC 0: 1
1: 2
2: 52
3: 435
4: 4909
Right 914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG 0: 1
1: 0
2: 1
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993117 Original CRISPR AGGGGCTGCTGCGGCGACTC AGG Exonic
900096050 1:940512-940534 AGTGGGGGCTGCGGGGACTCGGG + Intronic
902218665 1:14950679-14950701 TGTGGCTGCTGCGGCGGCCCTGG + Intronic
902337366 1:15761149-15761171 AGGGGCTGCTGTGGGGCTTCGGG - Intronic
902838120 1:19059574-19059596 GGGAGCTGCTGCCGTGACTCTGG - Intergenic
902876844 1:19345522-19345544 AAGGGCTGCTGCTGTGGCTCTGG - Intronic
903180380 1:21602219-21602241 TGGGGCTGCTGTGGGGACTCAGG - Intronic
904459217 1:30665546-30665568 AGGGGCTGCTGCCCTGCCTCAGG - Intergenic
906163996 1:43672143-43672165 AGGATCTGCTGCTGTGACTCAGG - Intronic
906209180 1:44002750-44002772 AGGGGATGCTGAAGGGACTCCGG - Intronic
907275350 1:53313927-53313949 AGGGGCTGCTGCTGAGATCCAGG + Intronic
907850395 1:58249971-58249993 AGCGGCTGCCGCGGCGGCTGTGG - Intronic
910188886 1:84574602-84574624 AGTGGCTGCTGGAGCGTCTCGGG + Intergenic
912956290 1:114155949-114155971 AGGCGCTTCTGCAGCGTCTCTGG + Intergenic
914198759 1:145465958-145465980 AGGGGCTGCTGCTTCGCCACTGG - Intergenic
914377467 1:147084934-147084956 AGGGGCTGCTGCTTCGTCACCGG - Intergenic
914477868 1:148039094-148039116 AGGGGCTGCTGCTTCGCCACTGG - Intergenic
914511333 1:148334945-148334967 AGGGGCTGCTGCTTCGCCACCGG - Intergenic
914993117 1:152515513-152515535 AGGGGCTGCTGCGGCGACTCAGG + Exonic
919733739 1:200931130-200931152 AGGGGCTGCTGGAGTGACCCAGG - Intergenic
920575813 1:207059597-207059619 AGGGGCTCCTGCTGAGACTCAGG + Intronic
921193419 1:212729856-212729878 AGGGGTTGCTGGGGTGACCCAGG + Intronic
921345972 1:214185509-214185531 GGAGGCTGCTGCAGCCACTCAGG + Intergenic
1065025489 10:21535449-21535471 CGGGGCTGCTGCAGCGCCTGTGG + Intronic
1065101617 10:22336653-22336675 AGCGGCTGCGGCGGCGGCCCTGG - Intergenic
1065114862 10:22475832-22475854 CGGGGCAGATGCGGCGACACTGG - Intergenic
1069620790 10:69836219-69836241 AGTGGCTGCTGCAGAGACCCAGG + Intronic
1069698347 10:70404324-70404346 CGGGGCTGCTTCGGCTCCTCAGG - Intergenic
1069841760 10:71344169-71344191 AGGAGGTGCTGCGGTCACTCAGG - Intronic
1075519963 10:123137257-123137279 AGGGGCGGCGGCGGCCACTCCGG + Exonic
1075829920 10:125399893-125399915 AGGGGCTCCTGGGGACACTCAGG + Intergenic
1076694278 10:132239652-132239674 AGGGGCTGCTGCAGTCACTGCGG - Intronic
1076764694 10:132626781-132626803 AGGGGTTCCTGTGGCGACTGTGG + Intronic
1076894263 10:133302163-133302185 AGGAGCTGCTGGGGGGAGTCAGG + Intronic
1076919508 10:133444454-133444476 AGGGGCTCCTGTGACCACTCAGG + Intergenic
1077252254 11:1565870-1565892 AGGGGCTGCTCCGACGGCCCAGG + Exonic
1077256369 11:1585227-1585249 ATGGGCTGTTGCGGCTGCTCCGG - Exonic
1077261245 11:1622071-1622093 ATGGGCTGCTGTGGCTGCTCTGG - Exonic
1077262405 11:1629841-1629863 ATGGGCTGCTGTGGCTGCTCCGG + Exonic
1077268913 11:1666059-1666081 ACGGGCTGCTGTGGCGGCTCTGG - Intergenic
1077271839 11:1685121-1685143 ATGGGCTGCTGTGGCGGCTCTGG + Intergenic
1077274440 11:1697246-1697268 ATGGGCTGCTGTGGCTGCTCTGG + Exonic
1077391724 11:2303458-2303480 AGAGCCTGCTGGGGCCACTCAGG + Intronic
1077483491 11:2827539-2827561 AGGGGCCCTTGCAGCGACTCAGG - Intronic
1078587976 11:12610487-12610509 AGGGCTTGCTGCGGCCACTTTGG - Intergenic
1078729411 11:13962236-13962258 AGGGTTAGATGCGGCGACTCCGG - Intergenic
1083622541 11:64056281-64056303 AGGGGCTGCAGCAGGGACCCTGG - Intronic
1084156884 11:67318079-67318101 AGGGGCTGGCGTGGCGACCCGGG + Intronic
1084284262 11:68121319-68121341 GGCGGCGGCTGCGGCGACTGCGG + Intronic
1084455458 11:69265593-69265615 AGGGGCTGGTGCAGCTACACAGG - Intergenic
1084537247 11:69764437-69764459 AGGGGCTGCTGCAGCCACCCAGG + Intergenic
1084800092 11:71538056-71538078 ATGGGCTGCTGTGGCTGCTCTGG + Exonic
1084801759 11:71548658-71548680 ATGGGCTGCTGTGGCTGCTCCGG + Exonic
1084803849 11:71565588-71565610 ATGGGCTGCTGTGGCTGCTCCGG + Exonic
1085320784 11:75572595-75572617 AGGGGCTTCTGGGCAGACTCTGG + Exonic
1088083131 11:105944694-105944716 AGATGCTGCTGCTGCAACTCGGG + Intronic
1088325114 11:108593287-108593309 AGCGGCTGCTGCGGAGGCTGCGG - Intronic
1088739367 11:112754371-112754393 AGGGGCTGCTTCTGCAACTGAGG - Intergenic
1089286219 11:117409728-117409750 AGGAGCGGCGGCGGCGACTGAGG - Exonic
1089534263 11:119150878-119150900 AGGGGCTGCAGGGGCTAGTCAGG - Intronic
1092052334 12:5480650-5480672 AGGGGTTGGTGGGGCCACTCTGG + Intronic
1092119862 12:6036352-6036374 AGGGGCTGCGCCGGGGACCCAGG - Intronic
1093822275 12:23635769-23635791 AGGGGCTGCTGTGGTGAATTAGG + Intronic
1097223075 12:57461720-57461742 AGTGCCTGCGGCGGCGACTTGGG + Intronic
1097903437 12:64896314-64896336 GGAGGCTGCTGCGACGACCCAGG + Intergenic
1105514067 13:21075591-21075613 GAGGGCCGGTGCGGCGACTCCGG + Intergenic
1106916196 13:34517276-34517298 AGGTGTTGCTGCAGCTACTCCGG - Intergenic
1113897710 13:113776379-113776401 AGGGGCTGACTCGGCGGCTCTGG + Intronic
1114419456 14:22568978-22569000 AGGGGCTGGTGCGGTGGCTTAGG - Intronic
1118971633 14:70642392-70642414 AGGGGCTGCTGCCGCCCCCCGGG + Exonic
1121270264 14:92633055-92633077 AGGGGCTGCTGCAGCCATCCTGG + Intronic
1122687065 14:103514102-103514124 AGGTGCTGCTGCTGTGACTTGGG + Intergenic
1122995364 14:105261004-105261026 AGGGGCTGCTGGGAGGACACAGG - Intronic
1123053597 14:105559348-105559370 TGGGGCTTCTGCGGGGACACTGG + Intergenic
1125339476 15:38660823-38660845 TGGGGCTGATGCTGAGACTCTGG - Intergenic
1127797510 15:62451331-62451353 AAGGGCTGCTGAGGAGAATCTGG + Intronic
1128322501 15:66703278-66703300 CGGGGCTGGTGCGGCGACTTTGG + Exonic
1129675975 15:77632631-77632653 AGAGGCGGCGGCGGCGGCTCCGG - Intronic
1132381689 15:101370642-101370664 AGAGGCTGCTGCGGCTCCCCGGG - Intronic
1133000875 16:2850831-2850853 AGGGAGTGCTGGGGTGACTCAGG - Intergenic
1133236913 16:4391800-4391822 AGGGGCTGCAGCTGGGACCCAGG + Intronic
1134057148 16:11177734-11177756 AGGGGCTGCTGTGGTTCCTCAGG - Intronic
1134164037 16:11915855-11915877 AGCTGCTGCCGCGGCGACGCCGG - Exonic
1136261764 16:29082206-29082228 CGCGGCGGCTGCGGAGACTCCGG - Intergenic
1138054972 16:53823315-53823337 TGAGGCTTCTGCTGCGACTCAGG + Intronic
1141566590 16:84906523-84906545 AGGGCCTCCTGCAGGGACTCTGG - Intronic
1141664044 16:85456766-85456788 GGAGGCTGCTGTGGCGACTCAGG + Intergenic
1142305483 16:89282075-89282097 ATGGGCTGCTGCGGCATCACAGG - Exonic
1142631584 17:1229416-1229438 CGGGGCGGCGGCGGAGACTCCGG - Intergenic
1143025048 17:3936567-3936589 AGGGGCTGCTGTGGAGACAGTGG - Intronic
1143583490 17:7839588-7839610 CAGGGCAGCTGGGGCGACTCAGG + Intergenic
1144659967 17:17061614-17061636 AGGGGCTGATGCCCCAACTCTGG - Intronic
1144777780 17:17793474-17793496 AGGGGCTGCTGGGGCGGCGGTGG - Exonic
1145305752 17:21674259-21674281 AGCGGCGGCTGCGGGGACTGGGG + Intergenic
1145370899 17:22305223-22305245 AGCGGCGGCTGCGGGGACTGGGG - Intergenic
1146956399 17:36938615-36938637 AGGGGCTTCTGGGCCGAGTCAGG - Intronic
1147038167 17:37697425-37697447 GGGGGCTGGTGCAGCGTCTCAGG + Intronic
1147440211 17:40443298-40443320 GGCGGCGGCGGCGGCGACTCAGG + Intergenic
1148840746 17:50495306-50495328 ACTGGCTGGTGCGGCGATTCTGG - Intergenic
1151612094 17:75182843-75182865 AGCGGCAGCTGAGGAGACTCCGG - Intergenic
1152644101 17:81460924-81460946 AGGGGCTGCCACGGCGGCCCAGG - Exonic
1152755313 17:82084734-82084756 TGGGGCTGCTGCGGGGCCTTCGG + Intronic
1156309462 18:35908941-35908963 AGGGGCTTCTGGGCAGACTCAGG + Intergenic
1157373153 18:47136987-47137009 AGTGGCAGCTGAGGAGACTCTGG + Intronic
1157687078 18:49651137-49651159 TGGGGCTGCTGCCGCGGCTATGG + Intergenic
1157804977 18:50651135-50651157 AGGTGCTGCTGGGGAGACTGGGG + Intronic
1158976512 18:62715785-62715807 AGCGGCGGCCGCGGCGGCTCTGG + Exonic
1159042079 18:63333813-63333835 GGGGCCTGCTGCGGCAACCCAGG + Intronic
1160768793 19:821386-821408 CGGGGCAGCTGCGCCGGCTCCGG + Intronic
1160953353 19:1678063-1678085 GGGGGCTGCAGGGGAGACTCTGG - Intergenic
1161068110 19:2248194-2248216 AGGGGCTGGTGGGTGGACTCCGG - Exonic
1161221222 19:3119126-3119148 AGGGGCAGCTGGGGGGACCCAGG - Intronic
1162958760 19:14114050-14114072 AGGGGCTGCAGCGGGGTCTGGGG - Intronic
1163282314 19:16325324-16325346 GGGGGCGGCGGCGGCGGCTCCGG - Exonic
1163328369 19:16619796-16619818 CGTGGCTGCTGTGGAGACTCGGG - Intronic
1163724563 19:18915291-18915313 AGGGGCGGCTGAGGCCACCCTGG - Intronic
1164423938 19:28123126-28123148 AGGGTCTGCTGAGAGGACTCAGG - Intergenic
1166343930 19:42153839-42153861 AGGGGCTGCCACGGAGACACTGG + Intronic
1166945505 19:46393762-46393784 AGAGGCTGCTGGGGAGTCTCAGG + Intergenic
1167633483 19:50639790-50639812 AGCGGCGGCAGCGGCGGCTCCGG - Intronic
925082811 2:1082986-1083008 AGGGGCTGCTGCTGTGTCTTGGG - Intronic
925394009 2:3519383-3519405 TGGAGCAGCTGCGGCGGCTCGGG - Exonic
926496704 2:13597880-13597902 AGGGGGTTCTGCGGTGACACAGG + Intergenic
926982301 2:18584857-18584879 CGGGGCAGCTGGGGCGACGCGGG + Exonic
928282911 2:29964459-29964481 AGGGGCTGCTGCTGGGGCTCAGG - Intergenic
929688900 2:44058405-44058427 ATTGGCTGCTGCTGAGACTCAGG + Intergenic
932042953 2:68319410-68319432 AGGGTCTGGCGCGGCGGCTCCGG + Exonic
932496539 2:72148498-72148520 CGGGGGTGCTGCGGCGGCTCTGG - Intergenic
936671821 2:114665045-114665067 GGGGGTTGCTGAGGGGACTCTGG + Intronic
937045130 2:118847095-118847117 CGCGGCGGCGGCGGCGACTCCGG - Exonic
937777166 2:125791815-125791837 GGGGGCTGCTGCTGTTACTCTGG + Intergenic
938379192 2:130827163-130827185 AGGGGCTGCTGCGGGATGTCTGG - Intergenic
938954234 2:136283373-136283395 AGGGGTTGCTGAGGCAGCTCAGG + Intergenic
939153927 2:138502140-138502162 TGGGGCTGCCGCGGGGACTGGGG - Intronic
939612935 2:144332300-144332322 AGGGGCAGCAGCGGCGGCTGCGG - Intronic
944863778 2:203840706-203840728 GAGGGCTGCTGCGGCCATTCTGG + Intergenic
947992257 2:234497054-234497076 GGCGGCTGCTGCGGCGGCGCGGG - Intergenic
1168814592 20:728170-728192 AGGGCTTCCTGCGGCGCCTCCGG - Intergenic
1169145455 20:3249143-3249165 ACGGGCTGCTCCGGCGTCTAGGG + Intergenic
1171531007 20:25853726-25853748 AGCGGCGGCTGCGGGGACTGGGG + Intronic
1171878493 20:30599250-30599272 TGGGGCTGCTGCTGGGATTCAGG + Intergenic
1172359643 20:34303157-34303179 GGGGGCTGCAGGGCCGACTCGGG - Intronic
1174847133 20:53953454-53953476 AGGGACTGCTGCCGCTTCTCAGG + Exonic
1175036139 20:56003645-56003667 AGAGGCTGCTGCGGCGGCGGGGG - Intronic
1175061706 20:56249348-56249370 TGGGTCTGCTGCGGCGTCTGTGG + Exonic
1175874125 20:62221431-62221453 AGGGGCTGCAGAGGGGACCCCGG + Intergenic
1176145938 20:63565499-63565521 CGGGCCTGCTGCAGGGACTCGGG + Exonic
1177580387 21:23015008-23015030 AAGGGCTGCTCCTGAGACTCAGG - Intergenic
1178893811 21:36542688-36542710 GGGGGCTGCTGGGGGGCCTCTGG - Intronic
1179464712 21:41563737-41563759 AGGGGCTGCAGCAGCGGCTCAGG + Intergenic
1179618224 21:42595417-42595439 AGGGAATGCTGCGGCCTCTCAGG + Intergenic
1180801947 22:18636086-18636108 GGGGGCTGCTGCGGGGACCGAGG + Intergenic
1180853185 22:19031627-19031649 GGGGGCTGCTGCGGGGACCGAGG + Intergenic
1181219773 22:21359175-21359197 GGGGGCTGCTGCGGGGACCGAGG - Intergenic
1181624848 22:24116382-24116404 AGGGGCAGATGTGGCCACTCTGG - Intronic
1182571692 22:31243992-31244014 AGGGGCTTCTGCTTCAACTCAGG + Intronic
1183095646 22:35550547-35550569 AGGGGCTGCTGTGGAGACGGTGG - Intronic
1183326772 22:37198783-37198805 GGGGGTTGCTGCGGGGACTGCGG - Intronic
1183481580 22:38068384-38068406 AGGGGCTGCAGCGCCCTCTCTGG - Intronic
1183935136 22:41257699-41257721 GGGGGCTGCAGAGGCGGCTCAGG + Intronic
1184712813 22:46263091-46263113 AGAGGCTGCCGCGGCCGCTCAGG + Exonic
950410189 3:12831156-12831178 GGGGGCTGCTGGGGCAGCTCTGG - Intronic
950534300 3:13570420-13570442 AGGGGCAGCTGCGGCCACGCTGG - Exonic
950692404 3:14670385-14670407 AGAGGCTGCTGTGGACACTCTGG - Intronic
951325867 3:21301293-21301315 AGGGCCTGCTGCAGCCACTGTGG - Intergenic
951543788 3:23806512-23806534 AGGGGCTGCGGCGGGGAATGGGG - Intronic
953980462 3:47410703-47410725 AGGGGCTGCTGTGGGGGCTGAGG - Exonic
954302120 3:49705578-49705600 AGGGGCTGCTCAGGCTCCTCGGG - Exonic
960712469 3:120545007-120545029 AGGGCTTGCTGCGGCCACTGTGG + Intergenic
961364980 3:126394047-126394069 AGGGGCTTCTGGGGGGACTCTGG - Intergenic
961785381 3:129344100-129344122 AGGCGCTGCTGCGCCCACACGGG - Intergenic
962475086 3:135748301-135748323 AGGGGCTGCTGGGCTGAATCTGG - Intergenic
963356010 3:144209435-144209457 AGGGGCTGTTGCCACTACTCAGG + Intergenic
964887687 3:161503229-161503251 AAGGGCTGCTGTGGAGATTCTGG + Exonic
966362955 3:179148980-179149002 AGGGGCTGCCGCGAGGACTGCGG + Intronic
968775436 4:2536964-2536986 CGGGGCGGCGGCGGCGGCTCGGG + Intronic
970333147 4:15004216-15004238 TGCGGCTGCTGCGGCGCCGCGGG - Exonic
975232998 4:71956742-71956764 AGGGGCTGTTGCAGTGACACAGG - Intergenic
975658828 4:76668138-76668160 AGCGGCAGCTGAGGAGACTCCGG + Intronic
976201034 4:82578984-82579006 AAGGGATGCTGCGACGACTCTGG + Intergenic
977582469 4:98740706-98740728 AGGGGCTGCTAGGGGGACTAGGG - Intergenic
978503472 4:109433567-109433589 AGGGGGCGCTGCGGCGGCACCGG + Intergenic
978795757 4:112706030-112706052 CGCGGCGGCTGCGGAGACTCCGG + Intergenic
982737104 4:159018240-159018262 AGGGGCTGCTGCAGCCACGTGGG - Intronic
984102365 4:175500351-175500373 AGGGGCTGCAGAGGTGTCTCAGG - Intergenic
985611708 5:892920-892942 AGCGGCTGTGGCGGCGACGCTGG + Exonic
985764670 5:1770574-1770596 AGCGGCTGCTGCTGCCACACAGG - Intergenic
986597508 5:9439068-9439090 CTGGGCTGCTGGGGCGTCTCAGG - Intronic
988817562 5:34849924-34849946 AGGGGCTGCTGTGGCCAGCCAGG + Intronic
992515984 5:77492466-77492488 GGGGGCGGCTGCGGCGATTGCGG + Exonic
997975417 5:138439095-138439117 AGCGGCTGCTGCTGCTACTGCGG + Exonic
998200427 5:140114109-140114131 AGCGGCGGCTGAGGCGACTGAGG + Exonic
1000394640 5:160760846-160760868 AGGGCCTACTGCGGCCACTGTGG - Intronic
1001803284 5:174561745-174561767 AGCGGCAGCTGAGGAGACTCCGG + Intergenic
1002169245 5:177366247-177366269 AGGGGCTGCTGGGACCACTGGGG - Exonic
1004620333 6:17325686-17325708 AGGGGCTGCTGCAGCTCCCCAGG - Intergenic
1004648094 6:17582003-17582025 AGGGGCAGCTGAGGAGACTCTGG + Intergenic
1005040437 6:21595548-21595570 CGGCGCTGCTGCGGCCGCTCAGG - Exonic
1005826704 6:29636352-29636374 AGCGGCAGCTGAGGAGACTCCGG - Intergenic
1006168848 6:32081622-32081644 AGGGGCTGCTCCAGGAACTCAGG + Intronic
1007249803 6:40487998-40488020 GGGGGCTGCTGCTGTGACTGGGG - Intronic
1007325059 6:41053362-41053384 AGAGGCTGCTGTGGCCACTGAGG + Exonic
1010124768 6:72419139-72419161 AGGGGCTGCTCCAGGGACCCAGG - Intergenic
1013359573 6:109382067-109382089 TCGGGGTGCGGCGGCGACTCCGG - Intronic
1014137689 6:117907736-117907758 AGCTGCTGCTGCGGCTGCTCAGG - Exonic
1014569872 6:122996256-122996278 CCGGGCTGCGGCGGCGGCTCCGG - Exonic
1015786108 6:136922595-136922617 TGGAGCTGCTGCGGCGCCTCGGG + Exonic
1017985063 6:159436410-159436432 AGCAGCTGCTGCAGCGACACTGG + Intergenic
1018952905 6:168390817-168390839 AGTGGCTGGTGCGGCGCCCCAGG - Intergenic
1019662484 7:2232595-2232617 AGGGACGGCTGCGGAGACCCAGG + Intronic
1019912085 7:4106843-4106865 AGGGGCTGCTGCGGGGTCAGCGG - Intronic
1019947663 7:4342776-4342798 AGTGGCTACTGCGGGGACTTTGG + Intergenic
1022114665 7:27251606-27251628 TGTGGCTGCGGTGGCGACTCGGG + Intergenic
1023488243 7:40709900-40709922 AGGTGCTGCTGCTGCTAGTCAGG + Intronic
1025296188 7:57776713-57776735 AGCGGCGGCTGCGGGGACTCGGG - Intergenic
1029149918 7:98472551-98472573 AGGAGCAGCTGCGGGGGCTCTGG + Intergenic
1029280939 7:99435114-99435136 AGGGGCTGATGCGGCCAATGTGG - Exonic
1029926702 7:104327040-104327062 AGGGGCTGCTGCTGAAACTGGGG - Intergenic
1030060262 7:105615940-105615962 GGGTGCTGCTGCTGCTACTCTGG + Intronic
1030699432 7:112622221-112622243 AGGGCCTGCTGCTGCCACCCTGG - Intergenic
1032525595 7:132576768-132576790 GGGGGCTGCGGTGGCGACGCCGG + Exonic
1033220536 7:139524052-139524074 AGGGGCTGCTGCGGCGATCCGGG + Exonic
1034251239 7:149692631-149692653 AGGGGAGGCTGCGGCGGCGCGGG - Intergenic
1034440186 7:151082256-151082278 AGGGGCTCCTGCGGGGAGTCCGG + Exonic
1035172153 7:157022788-157022810 AGGGGCTGCTGGGGGGAGGCTGG - Intergenic
1037529219 8:19757330-19757352 AGCGGCGGCGGCGGCGGCTCGGG + Intronic
1039901823 8:41758205-41758227 AGGGGCTGCTGCGGGGGCCTGGG - Intronic
1040888182 8:52288196-52288218 AGTGGCTTCTGCTGCTACTCAGG - Intronic
1042662352 8:71168908-71168930 AGGAGATGCTGCTGCTACTCTGG - Intergenic
1048983039 8:139713404-139713426 AGGGGCTGCTGGGGTGAGTTTGG + Intergenic
1049140355 8:140949307-140949329 AGGGGCTGCTGCCAAGACACAGG + Intronic
1050472621 9:6008219-6008241 GGGGGCCGCAGCGGCGGCTCCGG + Intergenic
1052644228 9:31211447-31211469 AGTGGCTGCTGTGAGGACTCTGG - Intergenic
1054721535 9:68609023-68609045 GGAGGCTGCAGAGGCGACTCTGG + Intergenic
1056186811 9:84143276-84143298 AGGGGCTGCTGCAGCCGCTGGGG - Intergenic
1056702610 9:88923673-88923695 AGCGGGGGCTGCAGCGACTCTGG + Intergenic
1058110945 9:101029856-101029878 AGGGGCTGCTGCTGCGGCGGCGG + Intronic
1059740068 9:117141458-117141480 AGCAGCAGCTGAGGCGACTCAGG - Intronic
1061999874 9:134210565-134210587 AGGGGCAGCTGCGTGGACTCAGG + Intergenic
1062028700 9:134352343-134352365 AGGGGCTGCCTCGGGGACCCTGG + Intronic
1062700549 9:137899611-137899633 AGGGGATGCTGTGGCGTCTTTGG + Intronic
1185735154 X:2490403-2490425 CCGGGCTGCTGGGACGACTCGGG + Exonic
1185761095 X:2690656-2690678 AGGGGCTGCAGGGGCGAGTGGGG + Intergenic
1187126926 X:16462592-16462614 AGAGGCTGCTGGGATGACTCGGG - Intergenic
1187547123 X:20266093-20266115 AGGGGCTGCTGCGGGGAGACCGG - Intronic
1190064883 X:47233067-47233089 AGCTGCTGCTGCGGCGGCTGTGG + Exonic
1190114794 X:47619543-47619565 AGAGGCCGCTGGGGCGACCCCGG + Exonic
1192529047 X:71870704-71870726 AGGGGCTGCTGCTGCCTTTCCGG + Intergenic
1197079396 X:122394153-122394175 AGGGCTTGCTGCGGCCACTGTGG - Intergenic