ID: 914993118

View in Genome Browser
Species Human (GRCh38)
Location 1:152515522-152515544
Sequence TGCGGCGACTCAGGCTGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 638}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993104_914993118 18 Left 914993104 1:152515481-152515503 CCGCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993099_914993118 30 Left 914993099 1:152515469-152515491 CCACCCCGGCGCCCGCCTCCTCC 0: 1
1: 2
2: 17
3: 174
4: 1764
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993116_914993118 -9 Left 914993116 1:152515508-152515530 CCGGCAGGGGCTGCTGCGGCGAC 0: 1
1: 0
2: 2
3: 27
4: 273
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993114_914993118 3 Left 914993114 1:152515496-152515518 CCTGCTGCGGCTCCGGCAGGGGC 0: 1
1: 0
2: 1
3: 62
4: 406
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993109_914993118 9 Left 914993109 1:152515490-152515512 CCTCCTCCTGCTGCGGCTCCGGC 0: 1
1: 0
2: 9
3: 108
4: 852
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993107_914993118 12 Left 914993107 1:152515487-152515509 CCTCCTCCTCCTGCTGCGGCTCC 0: 1
1: 2
2: 52
3: 435
4: 4909
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993106_914993118 15 Left 914993106 1:152515484-152515506 CCTCCTCCTCCTCCTGCTGCGGC 0: 1
1: 9
2: 70
3: 612
4: 6347
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993101_914993118 26 Left 914993101 1:152515473-152515495 CCCGGCGCCCGCCTCCTCCTCCT 0: 1
1: 1
2: 11
3: 171
4: 1133
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993103_914993118 19 Left 914993103 1:152515480-152515502 CCCGCCTCCTCCTCCTCCTGCTG 0: 1
1: 5
2: 88
3: 920
4: 3854
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993110_914993118 6 Left 914993110 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 321
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993100_914993118 27 Left 914993100 1:152515472-152515494 CCCCGGCGCCCGCCTCCTCCTCC 0: 1
1: 0
2: 15
3: 247
4: 2033
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638
914993102_914993118 25 Left 914993102 1:152515474-152515496 CCGGCGCCCGCCTCCTCCTCCTC 0: 1
1: 0
2: 39
3: 422
4: 2815
Right 914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993118 Original CRISPR TGCGGCGACTCAGGCTGCTG CGG Exonic
900206849 1:1435324-1435346 TGCCGTGACTCTGGGTGCTGGGG - Intronic
900299722 1:1970527-1970549 GGCGCCCACTCAGGCGGCTGTGG - Intronic
900379961 1:2378835-2378857 TGAGGCGTCACAGGCTGGTGGGG + Intronic
901352477 1:8609882-8609904 TGCAGCTACTCAGGAGGCTGAGG - Intronic
901446170 1:9309431-9309453 TCCCGCTACTCAGGATGCTGAGG - Intronic
901694819 1:10999083-10999105 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
901890506 1:12259429-12259451 TGCAGCTACTCAGGAGGCTGAGG - Intronic
902558764 1:17263028-17263050 TGCAGCTACTCAGGAGGCTGAGG - Intronic
902569379 1:17337259-17337281 TGCAGCTACTCAGGAGGCTGAGG - Intronic
902588606 1:17457519-17457541 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
902821459 1:18945801-18945823 TGCTCCGATTCTGGCTGCTGTGG - Intronic
903083743 1:20836095-20836117 TGCAGCTACTCAGGAAGCTGAGG - Intronic
903120084 1:21210527-21210549 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
903237625 1:21960399-21960421 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
903416009 1:23183612-23183634 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
903816373 1:26067157-26067179 GGAGGCGGCTCTGGCTGCTGCGG - Intronic
903946187 1:26964690-26964712 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
904062679 1:27724123-27724145 TCCAGCTACTCAGGCGGCTGAGG - Intergenic
904070655 1:27794138-27794160 TGCAGCTACTCAGGAGGCTGAGG - Intronic
904480608 1:30791074-30791096 TGAGGAGACACACGCTGCTGAGG - Intergenic
904791456 1:33025067-33025089 TGCAGCTACTCAGGAGGCTGAGG + Intronic
905989253 1:42319112-42319134 TCCGGCTACTCAGGAGGCTGAGG + Intronic
906559008 1:46740631-46740653 TCCAGCTACTCAGGATGCTGAGG - Intergenic
906627798 1:47339821-47339843 TGCAGCTACTCAGGAGGCTGAGG - Intronic
907059094 1:51402787-51402809 TGCAGCTACTCAGGAGGCTGAGG + Intronic
907206778 1:52779604-52779626 TGCAGCTACTCAGGAGGCTGAGG - Intronic
908129137 1:61057292-61057314 TGCGGCGGCTGCGGCGGCTGCGG + Intronic
908129774 1:61063723-61063745 TGCAGCTACTCAGGAGGCTGAGG - Intronic
908301155 1:62761828-62761850 TGGGGAGGCTCAGGCTGCAGGGG - Intergenic
909623907 1:77694423-77694445 TCCAGCTACTCAGGATGCTGAGG + Intergenic
910037248 1:82803246-82803268 TGCTGCTACTCAGGAGGCTGAGG + Intergenic
911613099 1:99978409-99978431 TGCAGCTACTCAGGAGGCTGAGG + Intronic
912161203 1:106987163-106987185 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
912236342 1:107855390-107855412 TGCAGCTACTCAGGAGGCTGAGG - Intronic
912280385 1:108306816-108306838 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
912855176 1:113162028-113162050 CGCGGCTACTCAGGAGGCTGAGG - Intergenic
912992484 1:114502620-114502642 TCCAGCTACTCAGGATGCTGAGG - Intronic
913014263 1:114716795-114716817 GGCGGGGACTCAGGCGCCTGGGG - Exonic
913613098 1:120527893-120527915 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
914371453 1:147028650-147028672 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
914543888 1:148643397-148643419 TGCAGCTACTCAGGAGGCTGAGG + Intronic
914578088 1:148994354-148994376 TGCAGCTACTCAGGAGGCTGAGG + Intronic
914759416 1:150586412-150586434 CCCAGCTACTCAGGCTGCTGAGG + Intergenic
914993118 1:152515522-152515544 TGCGGCGACTCAGGCTGCTGCGG + Exonic
915070326 1:153261100-153261122 TGCGGCTACTCCGGCGGCGGTGG + Exonic
915070453 1:153261520-153261542 GGCGGCGGCTCTGGCTGCGGCGG + Exonic
915238707 1:154503470-154503492 TGCAGCTACTCAGGAGGCTGAGG + Intronic
915509914 1:156381236-156381258 TGAGGAAACTGAGGCTGCTGAGG + Intronic
915524779 1:156468834-156468856 TGCGGCTGCTGAGGCTGCTGTGG + Exonic
915524791 1:156468906-156468928 TGCGGCTGCTGGGGCTGCTGTGG + Exonic
916035243 1:160916219-160916241 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
916486592 1:165265086-165265108 TCCGGCTACTCAGGAGGCTGAGG + Intronic
916683226 1:167122779-167122801 TGCAGCTACTCAGGAGGCTGAGG - Intronic
916911069 1:169347093-169347115 TGCAGCTACTCAGGAGGCTGAGG + Intronic
917331336 1:173883361-173883383 TCCGGCTACTCAGGAGGCTGAGG + Intronic
917348467 1:174053305-174053327 TTCGGCTACTCAGGAGGCTGAGG + Intergenic
917403845 1:174682163-174682185 TGCAGCTACTCAGGGGGCTGAGG + Intronic
917539321 1:175897890-175897912 TGAGGGGTCTCAGGGTGCTGAGG + Intergenic
917881022 1:179336046-179336068 TGCTGCTACTCAGGAGGCTGAGG + Intronic
918297499 1:183170815-183170837 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
918591164 1:186243048-186243070 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
918659519 1:187072516-187072538 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
919951202 1:202365324-202365346 TGTGGCTACTCAGGAGGCTGAGG + Intronic
921478374 1:215636052-215636074 AGCGGCCACACAGGCTGGTGTGG + Intronic
921483787 1:215693017-215693039 TGTGGTGACTCAGGAGGCTGAGG - Intronic
922444651 1:225686651-225686673 TCCAGCGACTCAGGAGGCTGAGG + Intergenic
922920100 1:229294712-229294734 TGCAGCTACTCAGGAGGCTGAGG + Intronic
923111731 1:230896214-230896236 TCCAGCTACTCAGGATGCTGAGG + Intergenic
923449512 1:234103500-234103522 GGCCAAGACTCAGGCTGCTGAGG - Intronic
924086721 1:240459599-240459621 TGCAGCTACTCAGGAGGCTGAGG + Intronic
924205287 1:241705701-241705723 TGCAGCCACTCAGGAGGCTGAGG - Intronic
924952325 1:248896558-248896580 TGCTGCTACTCAGGAGGCTGAGG - Intergenic
1064123936 10:12643115-12643137 TCCAGCTACTCAGGCTGCTAAGG - Intronic
1064646086 10:17461372-17461394 TCCAGCTACTCAGGCTGCTGAGG - Intergenic
1064760393 10:18613210-18613232 CGCAGCTACTCAGGATGCTGAGG - Intronic
1064770347 10:18716567-18716589 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1065005353 10:21374400-21374422 TGCAGCCACTCAGGAGGCTGAGG + Intergenic
1065113527 10:22462653-22462675 TCCAGCGACTCAGGCGACTGAGG - Intergenic
1065310373 10:24410110-24410132 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1065399234 10:25277593-25277615 TGTGGGAACTCAGGCTGCTATGG + Intronic
1065912206 10:30317971-30317993 TCCGGCTACTCAGGAGGCTGGGG - Intronic
1065923905 10:30418506-30418528 TCCAGCGACTCAGGAGGCTGAGG + Intergenic
1066141621 10:32509048-32509070 TGAGGCTACTCAGGAGGCTGAGG - Intronic
1066306829 10:34153224-34153246 TGCGGCCTCTCAGGAGGCTGAGG - Intronic
1067005348 10:42655512-42655534 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1067059741 10:43072124-43072146 TGCGGCCACCCAGGCTCCTGGGG - Intergenic
1067812587 10:49441613-49441635 TGCGGAGACGCCGGCGGCTGGGG - Intergenic
1068182992 10:53546332-53546354 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1069024178 10:63521786-63521808 TGCGGCGACTGCGGCTGCGACGG + Intronic
1069158040 10:65053871-65053893 TGAGGCGGCTGAGGCGGCTGAGG - Intergenic
1069738117 10:70670701-70670723 TCCAGCGAAGCAGGCTGCTGGGG + Intergenic
1069988114 10:72297919-72297941 GGAGGCCACTCAGGCCGCTGGGG - Intergenic
1070000085 10:72369822-72369844 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1070085053 10:73228979-73229001 GGTGGCGACTCAGGAGGCTGAGG - Intronic
1070153564 10:73819771-73819793 CGCCTCGCCTCAGGCTGCTGTGG + Intronic
1070873787 10:79782233-79782255 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1071358478 10:84821500-84821522 TCCCGCTACTCAGGGTGCTGAGG + Intergenic
1071654516 10:87433563-87433585 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1072261770 10:93683143-93683165 TGAGGCTACTCAGGCTATTGTGG - Intronic
1073342964 10:102759779-102759801 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1073471796 10:103727175-103727197 TGGGGACACTGAGGCTGCTGGGG + Intronic
1073507199 10:104007490-104007512 TCCAGCTACTCAGGCGGCTGAGG + Intronic
1075145560 10:119880077-119880099 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1075940016 10:126383058-126383080 TCCAGCTACTCAGGATGCTGAGG - Intronic
1076094401 10:127719608-127719630 TTCAGCTACTCAGGATGCTGAGG - Intergenic
1076705088 10:132297136-132297158 TCCTGCGCCTCTGGCTGCTGTGG + Intronic
1076894113 10:133301242-133301264 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1076904058 10:133353550-133353572 TGTGGCCACTCAGGGGGCTGAGG + Intergenic
1076940643 10:133604880-133604902 TGCAGCGGCACAGCCTGCTGTGG - Intergenic
1078683298 11:13501342-13501364 CCCAGCTACTCAGGCTGCTGAGG - Intergenic
1079406327 11:20149637-20149659 CCCAGCTACTCAGGCTGCTGAGG + Intergenic
1079958701 11:26895619-26895641 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1080499623 11:32857265-32857287 TGCAGCTACTCAGGAGGCTGAGG - Exonic
1080644201 11:34176162-34176184 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1081114862 11:39187805-39187827 GGCGGCTACTCAGGAGGCTGAGG + Intergenic
1081649996 11:44817510-44817532 TGCTGCGACTTAGGCTGAAGGGG + Intronic
1081953549 11:47068414-47068436 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1082066292 11:47903379-47903401 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1082818313 11:57525701-57525723 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1082915984 11:58437844-58437866 TCCAGCTACTCAGGCGGCTGAGG + Intergenic
1083577922 11:63805794-63805816 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1083632025 11:64100756-64100778 TGGGGCCTCTCAGGCTTCTGGGG - Intronic
1083930814 11:65843451-65843473 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1083985836 11:66214735-66214757 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1084284263 11:68121328-68121350 TGCGGCGACTGCGGCGACTGTGG + Intronic
1084628815 11:70331662-70331684 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1085140035 11:74131699-74131721 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1085280810 11:75329214-75329236 TCCAGCTACTCAGGCGGCTGAGG - Intronic
1085649319 11:78253124-78253146 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1087538787 11:99488286-99488308 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1087564933 11:99843106-99843128 TGCAGCTACTCAGGTGGCTGTGG + Intronic
1087693950 11:101354143-101354165 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1088431721 11:109766183-109766205 TGCGGCCACTCAGTCTCCTCAGG - Intergenic
1088800607 11:113303439-113303461 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1089851775 11:121503601-121503623 TGCAGCTACTCAGGAGGCTGGGG - Intronic
1089945821 11:122472297-122472319 TGCAGAAAATCAGGCTGCTGTGG + Intergenic
1091216923 11:133907799-133907821 TAGGGCGCCTCTGGCTGCTGGGG - Intergenic
1091882455 12:3990721-3990743 GGCGGGGGCCCAGGCTGCTGTGG + Intergenic
1091906287 12:4192019-4192041 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1092188363 12:6498721-6498743 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1092334010 12:7612389-7612411 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1092350127 12:7749437-7749459 TTCGGCTACTCAGGAGGCTGAGG + Exonic
1092470265 12:8772002-8772024 TCCGGCTACTCAGGAAGCTGAGG - Intronic
1092658601 12:10714867-10714889 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1093833160 12:23791415-23791437 TGCAGCTACTCCGGGTGCTGAGG - Intronic
1096133761 12:49182336-49182358 CCCGGCTACTCTGGCTGCTGAGG + Intergenic
1096157100 12:49346837-49346859 AGCGACGCCTCAGACTGCTGGGG - Intergenic
1096332213 12:50723633-50723655 TCCAGCGACTCAGGAGGCTGAGG + Intronic
1096367955 12:51044613-51044635 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1096661414 12:53126978-53127000 CTCGGCTACTCAGGCAGCTGAGG + Intergenic
1096662340 12:53133925-53133947 TGCAGCTACTCAGGAAGCTGAGG - Intergenic
1096713798 12:53478390-53478412 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1096942424 12:55361677-55361699 TCCAGCTACTCAGGCAGCTGAGG - Intergenic
1097697376 12:62787567-62787589 CCCAGCTACTCAGGCTGCTGAGG + Intronic
1097712996 12:62935162-62935184 TGCAAGGGCTCAGGCTGCTGCGG + Intergenic
1097797062 12:63873914-63873936 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1098851201 12:75598694-75598716 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1099949897 12:89290387-89290409 TCCAGCTACTCAGGCGGCTGAGG - Intergenic
1101144748 12:101830700-101830722 GGCGGCGGCTCAGGCTCCTCGGG - Exonic
1101497093 12:105265033-105265055 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1101861729 12:108487851-108487873 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1102255490 12:111412359-111412381 GGCGGCTGCTCAGGCTGCTCCGG - Intronic
1102993092 12:117328678-117328700 CGCAGCTACTCAGGCGGCTGAGG - Intronic
1103082086 12:118032581-118032603 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1103305755 12:119962733-119962755 TTCAGCTACTCAGGATGCTGAGG - Intergenic
1103509416 12:121464478-121464500 TGGGGAAACCCAGGCTGCTGAGG + Intronic
1103635399 12:122300678-122300700 GGCGGCTACTCAGGAGGCTGAGG - Intronic
1103653032 12:122448140-122448162 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1103699351 12:122840730-122840752 TGGGGGGACTCAGGCAGGTGGGG + Intronic
1104534803 12:129609054-129609076 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1105910487 13:24860991-24861013 CCCGGCTACTCAGGATGCTGAGG - Intronic
1105974130 13:25458463-25458485 TCCGGCTACTCAGGACGCTGAGG - Intronic
1106258529 13:28043728-28043750 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1106490896 13:30220813-30220835 TCCAGCTACTCAGGCGGCTGAGG - Intronic
1106492477 13:30239292-30239314 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1108003609 13:45926337-45926359 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1108474851 13:50804557-50804579 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1111515742 13:89328445-89328467 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1111830935 13:93328557-93328579 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1111843259 13:93475028-93475050 TGCAGCTACTCAGGAGGCTGTGG + Intronic
1112514062 13:100036799-100036821 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1112914946 13:104536809-104536831 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1112960641 13:105121082-105121104 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1113037550 13:106067560-106067582 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1113117619 13:106890475-106890497 TGTGGCTACTCAGGAGGCTGAGG - Intergenic
1113852490 13:113425794-113425816 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1116669812 14:47826999-47827021 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1116963400 14:50990131-50990153 TCCAGCTACTCAGGATGCTGAGG - Intronic
1117382710 14:55180997-55181019 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1117526702 14:56614262-56614284 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1117743898 14:58847803-58847825 CCCAGCCACTCAGGCTGCTGAGG + Intergenic
1118017866 14:61678781-61678803 TGAGGCTACTCAGGAGGCTGAGG + Intergenic
1118135729 14:63024091-63024113 TGCAGCTACTCAGGAGGCTGCGG + Intronic
1119429343 14:74555677-74555699 TGAGGCCACTCAGGGTCCTGTGG + Exonic
1119504673 14:75162147-75162169 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1119780027 14:77271185-77271207 TGGGGCGGCTCTGGCGGCTGCGG - Exonic
1121010082 14:90514779-90514801 CTTGGCTACTCAGGCTGCTGAGG + Intergenic
1121313770 14:92949207-92949229 TGCGGCTACTCAGGAGGCTGAGG - Intronic
1122611844 14:102989741-102989763 GGCGGCTACTCAGGAGGCTGAGG + Intronic
1123014207 14:105365815-105365837 GAAGGCGACTCAGGGTGCTGGGG + Intronic
1123433983 15:20241569-20241591 TCCATCTACTCAGGCTGCTGAGG + Intergenic
1123803234 15:23843982-23844004 TGCAGCTACTCAGGATGCTGAGG - Intergenic
1124588743 15:31035118-31035140 TTCGGCTACTCAGGAGGCTGAGG - Intronic
1124799908 15:32822231-32822253 TGCAGCTACTCAGGAAGCTGAGG + Intronic
1126558542 15:50018101-50018123 CCCAGCTACTCAGGCTGCTGAGG - Intronic
1126558712 15:50020068-50020090 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1127382164 15:58439557-58439579 CGCGGCTACTCAGGAGGCTGAGG - Intronic
1127502580 15:59568544-59568566 CGCGGCTACTCAGGTGGCTGAGG + Intergenic
1127634409 15:60855734-60855756 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1127949951 15:63794948-63794970 CCCAGCTACTCAGGCTGCTGAGG + Intronic
1129108193 15:73323079-73323101 GACGGCGGCTCAGGCTGCCGTGG + Exonic
1130252892 15:82312351-82312373 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1131175874 15:90209447-90209469 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1131489986 15:92854333-92854355 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1131664662 15:94557446-94557468 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1132009360 15:98261771-98261793 CCCAGCTACTCAGGCTGCTGAGG + Intergenic
1132245698 15:100294590-100294612 CCCGGCGACTCAGGAGGCTGAGG + Intronic
1132927909 16:2441278-2441300 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1133072980 16:3258854-3258876 TGCTGCTACTCAGGAGGCTGAGG + Intergenic
1133105401 16:3505121-3505143 TCCAGCGACTCAGGAGGCTGAGG + Intronic
1133106497 16:3513563-3513585 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1134302759 16:13006238-13006260 TGCAGCCACCCAGGTTGCTGAGG - Intronic
1134373152 16:13644684-13644706 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1134590347 16:15448003-15448025 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1135179770 16:20262599-20262621 CTCAGCGACTCAGGCGGCTGAGG + Intergenic
1135435161 16:22421791-22421813 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1135736513 16:24935922-24935944 CCCGGCTACTCAGGGTGCTGAGG - Intronic
1136130929 16:28220771-28220793 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1136244028 16:28963064-28963086 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1136631499 16:31491725-31491747 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1136648258 16:31641858-31641880 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1137384615 16:48030076-48030098 TGCTGGGACTCAGGCCCCTGGGG + Intergenic
1137601516 16:49759547-49759569 TGCTGCTCCTGAGGCTGCTGTGG - Intronic
1137640649 16:50025516-50025538 TGTGGGGACTCAGGGAGCTGAGG - Intronic
1138009906 16:53368842-53368864 TCCAGCGACTCAGGTGGCTGAGG - Intergenic
1138300140 16:55919163-55919185 TGGGGCGACTCAGCCTGTTCAGG - Intronic
1138590703 16:57998207-57998229 TGCGGTGGCTGTGGCTGCTGCGG + Exonic
1139767399 16:69242308-69242330 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1139916584 16:70432034-70432056 TGCAGCTACTCAGGAAGCTGAGG + Intronic
1140271864 16:73473219-73473241 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1140393312 16:74606883-74606905 TGCGATGACTGAGGCAGCTGGGG + Exonic
1140529484 16:75651571-75651593 CGCAGCTACTCAGGCAGCTGAGG + Intronic
1140640080 16:76961171-76961193 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1140803916 16:78515106-78515128 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1140813012 16:78596415-78596437 TGGGATGACACAGGCTGCTGTGG + Intronic
1141144458 16:81519181-81519203 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1141476550 16:84277669-84277691 TGCGGCTACTCAGGAGGCTGAGG - Intergenic
1141869697 16:86776222-86776244 TCCAGCTACTCAGGGTGCTGAGG - Intergenic
1141989606 16:87602555-87602577 TGCGGCGGCTCGGGCGGCGGCGG - Intronic
1142301521 16:89261327-89261349 TCCAGCTACTCAGGCGGCTGAGG + Intergenic
1142383930 16:89750365-89750387 CCCAGCGACTCAGGCGGCTGAGG + Intronic
1142402981 16:89870716-89870738 TGTGGGGACTCAGGCAGCAGAGG + Exonic
1203112245 16_KI270728v1_random:1457995-1458017 TCCATCTACTCAGGCTGCTGAGG - Intergenic
1142543799 17:683746-683768 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1142584195 17:960592-960614 TTCAGCTACTCAGGATGCTGAGG - Intronic
1142838305 17:2606476-2606498 TCCAGCTACTCAGGATGCTGAGG - Intronic
1142980385 17:3668074-3668096 GGCGGCGGCGCAGGCTGCAGCGG + Intronic
1143493387 17:7296527-7296549 AGAGGCGACTGCGGCTGCTGCGG - Intergenic
1143507467 17:7375781-7375803 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1143613727 17:8037145-8037167 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1144408204 17:14973460-14973482 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1144535255 17:16082604-16082626 TCCAGCTACTCAGGATGCTGAGG + Intronic
1144606201 17:16667246-16667268 TGAGGCGGCTGAGGCGGCTGAGG + Intergenic
1144606203 17:16667255-16667277 TGAGGCGGCTGAGGCGGCTGAGG + Intergenic
1144606213 17:16667289-16667311 TGAGGCGGCTGAGGCGGCTGAGG + Intergenic
1144827475 17:18114365-18114387 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1144840794 17:18184344-18184366 TGCGGCGGCTACGGCGGCTGCGG - Exonic
1144904963 17:18634850-18634872 TGAGGCGGCTGAGGCGGCTGAGG - Intergenic
1145410380 17:22655598-22655620 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1146772969 17:35586057-35586079 CCCGGCTACTCAGGCGGCTGAGG - Intronic
1147474322 17:40695485-40695507 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1147535041 17:41315376-41315398 TGCTGCGGCTCCGGGTGCTGTGG - Exonic
1147535064 17:41315502-41315524 TGCGGGGGCTCTGGCTGCGGGGG - Exonic
1147971179 17:44219750-44219772 TCCGGCGGCTGAGGCTGCGGCGG - Intronic
1148223230 17:45879922-45879944 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1148374725 17:47132887-47132909 TGCAGCTACTCAGGATGCTGAGG - Intronic
1148505253 17:48122063-48122085 TGCTGTGACTCCTGCTGCTGGGG + Exonic
1148531200 17:48394105-48394127 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1148656403 17:49286907-49286929 TGCGGTGGCTCAGGAGGCTGAGG + Intergenic
1149429103 17:56582535-56582557 TGTGAGGATTCAGGCTGCTGAGG + Intergenic
1149443302 17:56693365-56693387 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1149454633 17:56777848-56777870 GGTGGGGACTCAGGCTGCTTGGG - Intergenic
1149492777 17:57097045-57097067 TGCTGCGACTATGGCTCCTGTGG + Intronic
1149592534 17:57842125-57842147 TCCAGCTACTCAGGATGCTGAGG - Intronic
1149698440 17:58635543-58635565 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1149916010 17:60610062-60610084 CGCAGCTACTCAGGCGGCTGAGG + Intronic
1150259974 17:63781331-63781353 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1150339348 17:64354053-64354075 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1150377255 17:64691773-64691795 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1150741029 17:67779163-67779185 TGCGCCGGCTCAGGCAGCAGGGG - Intergenic
1151822660 17:76505418-76505440 TGAGGACACTGAGGCTGCTGTGG + Intergenic
1151907657 17:77059435-77059457 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1152488213 17:80609627-80609649 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1152664648 17:81560295-81560317 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1152853635 17:82651231-82651253 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1153172250 18:2329348-2329370 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1153647544 18:7208690-7208712 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1153719881 18:7891168-7891190 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1154154574 18:11933953-11933975 CCCGGCTACTCAGGATGCTGAGG - Intergenic
1154167592 18:12027689-12027711 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1154226308 18:12507581-12507603 TGCAGCCACTCAGGAGGCTGAGG + Intronic
1155133259 18:22960428-22960450 CCCAGCTACTCAGGCTGCTGAGG + Intronic
1155902760 18:31411339-31411361 TGCGGCCCCTGAGGCTCCTGCGG - Exonic
1155986680 18:32237697-32237719 TGCAGCCACTCAGGAGGCTGAGG + Intronic
1155988960 18:32259590-32259612 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1156580043 18:38364227-38364249 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1159312623 18:66729259-66729281 TCCAGCTACTCAGGCGGCTGAGG + Intergenic
1159613196 18:70549107-70549129 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1160537619 18:79603532-79603554 TGGGGCTACACAGGCTCCTGCGG - Intergenic
1160804323 19:985279-985301 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1160810380 19:1010617-1010639 TGCTGCCACTGAGGCTGCCGCGG + Exonic
1160959237 19:1711125-1711147 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1161038025 19:2096276-2096298 TGCGGCGGCTGAGGCGGCCGAGG - Exonic
1161395574 19:4043282-4043304 TGAGGCGACTGAGGCGGCAGCGG + Intergenic
1162040313 19:7967149-7967171 TGCAGCAACTCAGGAAGCTGAGG - Intronic
1162388527 19:10375499-10375521 TCCAGCTACTCAGGCGGCTGAGG + Intronic
1162421149 19:10566782-10566804 TTCTGCGCCTCAGGCTGCTGGGG - Exonic
1162520981 19:11179198-11179220 TCCAGCCACTCAGGATGCTGAGG + Intronic
1162546272 19:11332146-11332168 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1162713891 19:12616463-12616485 TGGGGCCACCCAGGCTGCTGGGG + Intronic
1163029027 19:14531536-14531558 TCCGGCTACTCAGGAGGCTGGGG - Intronic
1163629404 19:18409945-18409967 TCCAGCTACTCAGGCGGCTGAGG - Intergenic
1163714750 19:18867273-18867295 TGCGGGGCATCAGGCTGCTGGGG + Exonic
1163832588 19:19554220-19554242 TGGGGCAACTCAGGCAGCCGCGG - Intergenic
1163963231 19:20717538-20717560 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1164052179 19:21592919-21592941 TGCTGCTCCTCAGTCTGCTGTGG + Intergenic
1164313510 19:24066782-24066804 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1164865322 19:31599807-31599829 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1164957048 19:32395343-32395365 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1164991872 19:32690729-32690751 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1165117803 19:33539347-33539369 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1165803889 19:38568634-38568656 TCCAGCTACTCAGGATGCTGAGG + Intronic
1165909384 19:39215530-39215552 CCCGGCTACTCAGGCAGCTGAGG - Intergenic
1167005202 19:46771693-46771715 TCCAGCCACTCAGGATGCTGAGG + Intronic
1167039089 19:47011744-47011766 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1167145785 19:47680332-47680354 TGCGGGGCCTTGGGCTGCTGCGG - Exonic
1167351735 19:48979450-48979472 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1167453478 19:49585680-49585702 TCCAGCTACTCAGGCGGCTGAGG + Intronic
1167578501 19:50328988-50329010 GGCGGGGACTCGGGCGGCTGCGG + Exonic
1167788277 19:51653915-51653937 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1168156546 19:54476417-54476439 TGCAGCAACTCAGGAGGCTGAGG - Intergenic
926784744 2:16508346-16508368 TGCGGCGTCTGCGGCTTCTGCGG + Intergenic
927417600 2:22894949-22894971 TGCTGCCTCTCAGGCTGCTCAGG - Intergenic
927625947 2:24718751-24718773 GGCGGCTACTCAGGAGGCTGAGG + Intronic
927984802 2:27401708-27401730 TCCAGCTACTCAGGATGCTGAGG + Intronic
928146792 2:28785691-28785713 CGCGGCTACTCAGGAGGCTGAGG + Intronic
928162993 2:28946191-28946213 GGCGGCTACTCAGGAGGCTGAGG + Intronic
929168430 2:38906840-38906862 GGCAGCTACTCAGGCAGCTGAGG + Intronic
929171006 2:38933497-38933519 TCCAGCTACTCAGGATGCTGAGG - Intronic
929178782 2:39010198-39010220 TGCAGCTACTCAGGAGGCTGAGG + Intronic
932029513 2:68169042-68169064 TGCAGCTACTCAGGAGGCTGAGG - Intronic
932437228 2:71709629-71709651 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
932732375 2:74230490-74230512 TCCGGCTACTCAGGAGGCTGAGG - Intronic
932762716 2:74449632-74449654 TCCAGCTACTCAGGATGCTGAGG + Intergenic
935223595 2:101035233-101035255 TGCTGCTCCTCAGGGTGCTGTGG - Intronic
935957954 2:108397460-108397482 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
936107725 2:109639824-109639846 CGCAGCTACTCAGGATGCTGAGG - Intergenic
936377073 2:111950051-111950073 TTCGGCTACTCAGGAGGCTGAGG - Intronic
937417076 2:121724023-121724045 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
937926885 2:127174493-127174515 TGCCGCCTCTCATGCTGCTGAGG - Intergenic
938634846 2:133212481-133212503 TGCAGCTACTCAGGAAGCTGAGG - Intronic
940407889 2:153326966-153326988 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
940850676 2:158685447-158685469 TCCAGCTACTCAGGATGCTGAGG - Intergenic
940931320 2:159435469-159435491 TGCAGCTACTCAGGAGGCTGAGG - Intronic
941113384 2:161443311-161443333 TTCAGCTACTCAGGCAGCTGAGG - Intronic
942083476 2:172423718-172423740 TTCAGCTACTCAGGATGCTGAGG - Intergenic
944769200 2:202896573-202896595 TGCAGCCACTCAGGAGGCTGAGG + Intronic
945461947 2:210119066-210119088 TGCAGCTACTCAGGAGGCTGAGG + Intronic
946906344 2:224420140-224420162 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
946945573 2:224818511-224818533 TCCAGCTACTCAGGATGCTGAGG - Intronic
947162068 2:227225025-227225047 TCCAGCTACTCAGGATGCTGAGG - Intronic
947290391 2:228567410-228567432 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
947762145 2:232610759-232610781 CGCGGCTACTCAGGAGGCTGAGG + Intronic
947899152 2:233705971-233705993 TCCGGCTACTCAGGAGGCTGAGG + Intronic
948987616 2:241534887-241534909 TGGGTCGACTCAGGATGCAGCGG - Intergenic
1169366759 20:4998918-4998940 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1170208601 20:13825448-13825470 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1170628929 20:18051846-18051868 TCAGGCTACTCAGGATGCTGAGG - Intronic
1170634267 20:18091215-18091237 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1171062744 20:21982235-21982257 GGCAGTGACTCAGGCTTCTGTGG + Intergenic
1171078834 20:22156798-22156820 TGTGGTGACCCATGCTGCTGAGG + Intergenic
1171139581 20:22729345-22729367 TCCTGTGACTAAGGCTGCTGTGG - Intergenic
1171221058 20:23398483-23398505 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1171340600 20:24424173-24424195 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1172037731 20:32021538-32021560 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1172817881 20:37703891-37703913 CCCGGCGACTCAGGAGGCTGAGG - Intronic
1172907800 20:38381950-38381972 TCCAGCTACTCAGGCGGCTGAGG - Intergenic
1173533132 20:43786137-43786159 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1174027267 20:47588248-47588270 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1174158339 20:48531977-48531999 AGCTGCTACTCAGGATGCTGAGG + Intergenic
1174310629 20:49651168-49651190 TCCGGCTACTCAGGAGGCTGAGG + Intronic
1174482295 20:50839988-50840010 TCCAGCTACTCAGGATGCTGGGG - Intronic
1174596911 20:51691351-51691373 TGCGGCTACTCAGGAGGCTGAGG + Intronic
1174635328 20:51994657-51994679 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1175086713 20:56465448-56465470 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1175975754 20:62709613-62709635 TTCGGCGACGCCGGCTGCCGCGG + Exonic
1177293531 21:19146681-19146703 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1177577017 21:22971390-22971412 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1177803824 21:25854741-25854763 CCCAGCGACTCAGGATGCTGAGG + Intergenic
1177967683 21:27748753-27748775 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1178069700 21:28950629-28950651 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1178116776 21:29426053-29426075 TCCCGCTACTCAGGCGGCTGAGG - Intronic
1178873535 21:36395164-36395186 TCCAGCTACTCAGGATGCTGAGG - Intronic
1178991072 21:37357306-37357328 TCCAGCGACTCAGGAGGCTGAGG - Intergenic
1179523383 21:41959790-41959812 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1179582066 21:42350415-42350437 TTCAGCTACTCAGGCGGCTGAGG + Intronic
1180378291 22:12114508-12114530 TACGGAGACACTGGCTGCTGTGG - Intergenic
1181015644 22:20066907-20066929 TTAGGGGCCTCAGGCTGCTGGGG - Intergenic
1181544942 22:23597385-23597407 TGCGGCCACTCAGGAAGCTAAGG + Intergenic
1181788887 22:25247736-25247758 TGTGGCTACTCAGGAGGCTGAGG - Intergenic
1181815370 22:25432493-25432515 TGCGGCCACTCAGGAAGCTAAGG - Intergenic
1182224214 22:28783155-28783177 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1182428568 22:30287465-30287487 TGCGGCAGTGCAGGCTGCTGGGG - Exonic
1182643773 22:31790860-31790882 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1182650248 22:31845653-31845675 TGCGGAGACTCAGGCTTCTGGGG + Intronic
1182993006 22:34785768-34785790 TGCAGCTACTCAGGAAGCTGAGG - Intergenic
1183194816 22:36346029-36346051 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1183448819 22:37879057-37879079 TCCAGCTACTCAGGATGCTGAGG - Intronic
1183974093 22:41500498-41500520 TGCAGCTACTCAGGAAGCTGAGG - Intronic
1184426883 22:44414525-44414547 TCCGGCGACTCGGGAGGCTGAGG - Intergenic
1184715022 22:46276580-46276602 TCCGGCTACTCAGGAGGCTGTGG + Intronic
1185268022 22:49914841-49914863 TGCGGCTACTCAGGAGGCTCAGG - Intronic
950316264 3:12004452-12004474 TGAGGCGACTGAGGCGGCTGAGG - Exonic
952305827 3:32145201-32145223 TGCAGCTACTCAGGAGGCTGAGG + Intronic
952790105 3:37193575-37193597 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
953767864 3:45758029-45758051 TCCAGCTACTCTGGCTGCTGAGG - Exonic
954229993 3:49209518-49209540 TGCGGCTACTCAGGAGGCTGAGG + Intronic
954242491 3:49304877-49304899 TCCAGCTACTCAGGATGCTGAGG - Intronic
954841211 3:53513516-53513538 TGCAGCTACTCAGGAGGCTGAGG + Intronic
954917384 3:54160382-54160404 TCCAGCTACTCAGGATGCTGAGG + Intronic
956727797 3:72170725-72170747 TCCAGCTACTCAGGATGCTGAGG - Intergenic
957330017 3:78750335-78750357 TGCAGCTACTCAGGAGGCTGAGG + Intronic
957953187 3:87150307-87150329 TGCTGAGACACAGGTTGCTGTGG + Intergenic
958195796 3:90240671-90240693 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
958418969 3:93909317-93909339 TCCAGCTACTCAGGCGGCTGAGG + Intronic
959144616 3:102529860-102529882 TGTGGGGAATCAGGCTGCAGAGG - Intergenic
960389351 3:117057706-117057728 TGCAGCTACTCAGGAGGCTGAGG - Intronic
960923308 3:122770583-122770605 TGCAGCTACTCGGGCAGCTGAGG + Intronic
961222152 3:125209707-125209729 TGCAGTGACACAGGATGCTGTGG + Intronic
962328623 3:134457544-134457566 TGCGGAGGCTCAGGAGGCTGAGG - Intergenic
964780473 3:160331773-160331795 TCCAGCTACTCAGGATGCTGAGG - Intronic
965141061 3:164835304-164835326 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
965683988 3:171282455-171282477 TGCAGCTACTCAGGAGGCTGAGG - Intronic
966817449 3:183900761-183900783 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
967001176 3:185336424-185336446 TGCAGCTACTCAGGAGGCTGAGG + Intronic
968780552 4:2577532-2577554 TGCAGCTACTCAGGAGGCTGAGG - Intronic
968783502 4:2601002-2601024 TGCGGCTACACAGGAGGCTGAGG + Intronic
968819553 4:2839681-2839703 TCCGGCTACTCAGGAGGCTGAGG - Exonic
969051150 4:4373853-4373875 TGCAGCGACTGAGCCTGCCGTGG - Intronic
969239001 4:5887631-5887653 TGGGGCGACGCTGGCGGCTGCGG - Intronic
969245895 4:5932549-5932571 TGCAGCTACTCAGGAGGCTGAGG - Intronic
969276180 4:6137291-6137313 TGCAGCCACTGTGGCTGCTGTGG - Intronic
969391002 4:6891316-6891338 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
970807504 4:20053709-20053731 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
971726548 4:30321028-30321050 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
972054703 4:34785013-34785035 TCCAGCTACTCAGGATGCTGAGG - Intergenic
972191456 4:36596649-36596671 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
972277273 4:37568979-37569001 TGCAGCTACTCAGGAGGCTGAGG + Intronic
972316407 4:37930575-37930597 TGCAGCTACTCAGGAGGCTGAGG - Intronic
973728131 4:53796246-53796268 TGCAGCTACTCAGGAGGCTGAGG + Intronic
973908680 4:55556947-55556969 TGCAGCTACTCAGGAGGCTGAGG - Intronic
974040064 4:56849547-56849569 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
975045909 4:69803715-69803737 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
975079956 4:70265263-70265285 TCCAGCTACTCAGGATGCTGAGG + Intergenic
975700007 4:77055580-77055602 CGCAGCTACTCAGGATGCTGAGG - Intronic
976068331 4:81215023-81215045 TCCGGCGCCGCAGGCGGCTGGGG - Exonic
976650521 4:87429265-87429287 TGCCGCTACTCAGGAAGCTGAGG - Intronic
977323674 4:95549161-95549183 TGCGGCTGCTCCTGCTGCTGGGG - Exonic
979341614 4:119531392-119531414 CGCAGCTACTCAGGATGCTGAGG - Intronic
980930158 4:139177072-139177094 TGGAGCGGCTCGGGCTGCTGGGG - Exonic
982478795 4:155883654-155883676 TGCAGCTACTCAGGATGCTGAGG + Intronic
982620885 4:157703454-157703476 TGCAGCTACTCAGGTGGCTGAGG + Intergenic
982987302 4:162226655-162226677 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
983317001 4:166145290-166145312 TCCAGCCACTCAGGTTGCTGAGG - Intergenic
984183682 4:176515753-176515775 TTCAGCTACTCAGGATGCTGAGG - Intergenic
984361858 4:178744065-178744087 TGGGGGGATTCAGGCTGCAGTGG + Intergenic
984535522 4:180969985-180970007 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
984734764 4:183099001-183099023 TGCGGCGACGCCGGCAGCGGCGG + Intergenic
984888899 4:184474131-184474153 TGCTGCTACTGGGGCTGCTGAGG - Intronic
985042970 4:185910689-185910711 CTCGGCGACTCAGGAGGCTGAGG - Intronic
985432366 4:189893748-189893770 TCCTGCTACTCAGGCTTCTGAGG + Intergenic
1202759912 4_GL000008v2_random:99974-99996 TACGGAGACACTGGCTGCTGTGG - Intergenic
985845499 5:2343095-2343117 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
986821982 5:11477525-11477547 TCCAGCTACTCAGGCAGCTGAGG - Intronic
986840600 5:11692715-11692737 TGCAGCTACTCAGGAAGCTGAGG - Intronic
987084430 5:14455932-14455954 TGCGGAGGCTCAGGCTGCGTGGG + Intronic
987289878 5:16498594-16498616 TGCAGCTACTCAGGGGGCTGAGG + Intronic
987384462 5:17315959-17315981 TCCAGCGACTCAGGAGGCTGAGG - Intergenic
987702880 5:21424402-21424424 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
987897873 5:23971951-23971973 TGCAGCTACTCAGGAAGCTGAGG - Intronic
987935428 5:24457812-24457834 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
988498774 5:31766843-31766865 TGCAGCTACTCAGGAGGCTGAGG - Intronic
988573287 5:32393457-32393479 TCCGGCTACTCAGGAGGCTGAGG - Intronic
988640728 5:33038355-33038377 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
988738804 5:34049266-34049288 GGCTGAGACTCAGGCTTCTGAGG - Intronic
988803992 5:34722982-34723004 TGCAGCTACTCAGGAGGCTGAGG + Intronic
989068475 5:37486457-37486479 CCCGGCTACTCAGGATGCTGAGG - Intronic
989971537 5:50530969-50530991 TGCAGCTACTCAGGCGTCTGAGG + Intergenic
989999934 5:50880728-50880750 TCCAGCTACTCAGGATGCTGAGG + Intergenic
990577392 5:57136351-57136373 TGCAGCTACTCAGGAAGCTGAGG + Intergenic
992238010 5:74732068-74732090 CCCAGCGACTCAGGATGCTGAGG - Intronic
992817019 5:80452317-80452339 TGCAGCTACTCAGGAGGCTGAGG + Intronic
992863465 5:80935194-80935216 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
993664265 5:90675670-90675692 TGCAGCTACTCTGGATGCTGAGG + Intronic
993719145 5:91305025-91305047 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
994736886 5:103566658-103566680 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
997151412 5:131500012-131500034 TGCAGCTACTCAGGAGGCTGAGG - Intronic
998072829 5:139211653-139211675 TGCAGCTACTCAGGAGGCTGAGG + Intronic
998088310 5:139345159-139345181 TGCAGCTACTCAGGAGGCTGAGG - Intronic
998890416 5:146739892-146739914 TGAGGGAACTCAGTCTGCTGAGG + Intronic
1000808156 5:165823804-165823826 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1000817195 5:165938036-165938058 TCCAGCTACTCAGGCGGCTGAGG - Intergenic
1000890318 5:166793994-166794016 TGCAGCTACTCAGGAAGCTGAGG - Intergenic
1000936960 5:167313519-167313541 CCCGGCTACTCAGGCGGCTGAGG + Intronic
1001074237 5:168613527-168613549 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1001390722 5:171377062-171377084 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1001776842 5:174335316-174335338 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1001908249 5:175491598-175491620 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1001911782 5:175525722-175525744 TCCAGCTACTCAGGATGCTGAGG - Intronic
1002435949 5:179230893-179230915 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1002647177 5:180664633-180664655 CCCGGCGACTCAGGAGGCTGAGG + Intergenic
1002958515 6:1892473-1892495 TCCTGCTACTCAGGATGCTGAGG - Intronic
1003135987 6:3435121-3435143 GGCTGGGATTCAGGCTGCTGGGG + Intronic
1003172590 6:3731918-3731940 TGCTGCTGCTGAGGCTGCTGTGG + Intronic
1004215965 6:13704513-13704535 TGCAGCTATTCAGGATGCTGAGG + Intronic
1004223835 6:13769207-13769229 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1006178490 6:32138694-32138716 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1007479129 6:42138405-42138427 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1007522774 6:42465025-42465047 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1007677651 6:43610610-43610632 AGCAGCGGCGCAGGCTGCTGAGG - Exonic
1009246526 6:61245156-61245178 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1009417270 6:63429618-63429640 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1011512692 6:88118471-88118493 TGCGGCTACTTAGGAGGCTGAGG + Intergenic
1013045918 6:106484873-106484895 TCCGGCCACTCAGGAGGCTGAGG + Intergenic
1013162808 6:107562144-107562166 TCCAGCTACTCAGGATGCTGAGG - Intronic
1013266658 6:108506321-108506343 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1013345870 6:109260070-109260092 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1013525998 6:110974360-110974382 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1013532370 6:111031823-111031845 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1013803904 6:113975736-113975758 TGCGGCTACTCAGGAGGCTGAGG + Intronic
1013836647 6:114342589-114342611 TGCGCGGACTCCGGCTCCTGCGG - Exonic
1013899302 6:115133770-115133792 TCCAGCGACTCAGGAGGCTGAGG + Intergenic
1014576945 6:123085264-123085286 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1014641862 6:123921813-123921835 TGCCGCTACTCAGGAGGCTGAGG + Intronic
1014913364 6:127118785-127118807 TGCGGCGGCTGCGGCTGCAGCGG - Exonic
1014934551 6:127372470-127372492 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1015559228 6:134496733-134496755 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1016229957 6:141790434-141790456 TCCAGCGACTCAGGAGGCTGAGG - Intergenic
1016682100 6:146843210-146843232 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1016703585 6:147080786-147080808 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1016955142 6:149619495-149619517 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1017088281 6:150735100-150735122 TCCAGCTACTCAGGATGCTGAGG - Intronic
1018016733 6:159719410-159719432 CCCAGCTACTCAGGCTGCTGAGG + Intronic
1018145158 6:160879076-160879098 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1019083898 6:169456478-169456500 TGGGGCATCACAGGCTGCTGAGG + Intergenic
1019143710 6:169963424-169963446 TGCGGCTGCTGAGGCTGCTCCGG - Intergenic
1019368778 7:649936-649958 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1019371301 7:663342-663364 TGCAGCTACTCAGGAAGCTGAGG - Intronic
1019408340 7:895564-895586 TGCGGCGGCTCAGGGTGGCGCGG + Exonic
1020170549 7:5841427-5841449 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1020227851 7:6294273-6294295 TGCAGCTACTCGGGGTGCTGAGG - Intergenic
1020344675 7:7150099-7150121 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1020388459 7:7632872-7632894 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1020440551 7:8212447-8212469 TCCGGCTACTCAGGAAGCTGGGG + Intronic
1020644312 7:10795665-10795687 CGCAGCTACTCAGGATGCTGAGG + Intergenic
1021786761 7:24159936-24159958 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1022377441 7:29827909-29827931 TCCGGCTACTCAGGAGGCTGAGG - Intronic
1022667776 7:32428046-32428068 GGTGGCGCCTCAGGCTGCGGTGG + Intergenic
1024049332 7:45608922-45608944 TGCCAGGACTCAGGCAGCTGAGG + Intronic
1024511304 7:50207051-50207073 TGCGGCGATAGAGGGTGCTGTGG - Intergenic
1024604171 7:51011218-51011240 TGTGGCACCTCAGGTTGCTGTGG - Intergenic
1024933743 7:54691057-54691079 TGCGGCGACTCGGGTTTCTGTGG - Intergenic
1025220357 7:57102631-57102653 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1025631136 7:63274212-63274234 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1026679949 7:72459025-72459047 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1026742639 7:72988771-72988793 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1026802491 7:73409170-73409192 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1026804427 7:73421091-73421113 AGCAGCTACTCAGGATGCTGAGG + Intergenic
1026849056 7:73713612-73713634 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1027101096 7:75376307-75376329 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1027148463 7:75715273-75715295 TCCAGCGACTCAGGAGGCTGAGG + Intronic
1027455633 7:78387808-78387830 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1028153675 7:87405540-87405562 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1028637470 7:93005565-93005587 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1029184829 7:98731037-98731059 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1029541202 7:101183185-101183207 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1029599900 7:101557574-101557596 AGCGGCGGCTCAGGCCTCTGGGG - Exonic
1029727481 7:102416793-102416815 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1030018253 7:105245832-105245854 TGTGGCTACTCTGGCAGCTGAGG - Intronic
1031550594 7:123107308-123107330 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1032212274 7:129926558-129926580 TTCAGCGACTCAGGAGGCTGAGG - Intronic
1033017201 7:137683489-137683511 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1033730549 7:144174500-144174522 TCCAGCTACTCAGGCAGCTGAGG + Intergenic
1034603636 7:152288416-152288438 TCCAGCGACTCAGGAGGCTGAGG + Intronic
1035188619 7:157145400-157145422 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1035825716 8:2642433-2642455 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1036190154 8:6662841-6662863 TGCAGCCACTCAGGAGGCTGAGG - Intergenic
1036526913 8:9543408-9543430 TGCAGCTACTCAGGAGGCTGGGG - Intergenic
1037316072 8:17600685-17600707 TGCAGCTACTCAGGATGCTGTGG + Intronic
1038862702 8:31404849-31404871 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1039122337 8:34161104-34161126 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1039926054 8:41933232-41933254 GGCGGCGGCTGTGGCTGCTGTGG + Exonic
1039946756 8:42136304-42136326 TCCAGCTACTCAGGATGCTGAGG + Intergenic
1039987295 8:42458505-42458527 TCCGGCTACTCAGGGGGCTGAGG + Intronic
1040280147 8:46036755-46036777 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1041669553 8:60478893-60478915 TGCAGCTACTCAGGAAGCTGAGG - Intergenic
1042424430 8:68631144-68631166 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1042492975 8:69422559-69422581 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1042557203 8:70043485-70043507 TCCGGCTACTCAGGAGGCTGAGG + Intergenic
1042794678 8:72648385-72648407 TTCAGCTACTCAGGCGGCTGAGG - Intronic
1042987987 8:74604542-74604564 TGCGGCTGCTCAAGCTGCTCTGG + Intronic
1045250356 8:100478332-100478354 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1046175773 8:110573067-110573089 TGAGGCTACTCAGGAGGCTGAGG + Intergenic
1047724824 8:127674921-127674943 TGCAGCTACTCAGGAAGCTGAGG + Intergenic
1047761417 8:127957450-127957472 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1049127560 8:140805441-140805463 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1049162098 8:141104184-141104206 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1049360323 8:142209689-142209711 CGTGGAGGCTCAGGCTGCTGTGG - Intergenic
1049610266 8:143551951-143551973 TGCGCCTACTCAGGAGGCTGAGG - Intergenic
1049794185 8:144489086-144489108 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1050543579 9:6690810-6690832 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1050625365 9:7498463-7498485 AGTGGTGACTCAGGCTACTGTGG - Intergenic
1051026935 9:12624241-12624263 CCCGGCTACTCAGGATGCTGAGG + Intergenic
1051503058 9:17798873-17798895 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1053068643 9:35087309-35087331 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1053263524 9:36693463-36693485 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1053339983 9:37317459-37317481 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1054709190 9:68494140-68494162 TCCGGCTACTCTAGCTGCTGTGG + Intronic
1055307210 9:74942316-74942338 TGTGGCTACTCAGGAGGCTGAGG + Intergenic
1056307099 9:85300955-85300977 TGCAGCTACTCAGGAAGCTGAGG - Intergenic
1056632396 9:88304700-88304722 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1058446161 9:105057166-105057188 CCCGGCTACTCAGGATGCTGAGG + Intergenic
1058455709 9:105136245-105136267 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1059407592 9:114111311-114111333 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1059454811 9:114393329-114393351 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1060504183 9:124185939-124185961 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1060791581 9:126489078-126489100 TGGGGCTCCTCAGGATGCTGGGG - Intronic
1061166782 9:128927489-128927511 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1061265271 9:129501131-129501153 TGAGGAGACTCTGGCTTCTGGGG - Intergenic
1061347355 9:130037236-130037258 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1061827541 9:133269874-133269896 TGCAGCTACTCAGGAGGCTGAGG + Intronic
1062437964 9:136555145-136555167 TGTGGCCACTCCGGCTGCAGAGG + Intergenic
1203540685 Un_KI270743v1:84868-84890 TACGGAGACACTGGCTGCTGTGG - Intergenic
1185697151 X:2203877-2203899 TGCAGCTACTCAGGAGGCTGAGG - Intergenic
1188536727 X:31204736-31204758 CGCAGCTACTCAGGCGGCTGAGG - Intronic
1189157398 X:38772665-38772687 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1189243557 X:39544000-39544022 TCCAGCGACTCAGGAGGCTGAGG + Intergenic
1190041655 X:47077281-47077303 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1192095813 X:68209448-68209470 TGCAGCCACTCAGGAGGCTGAGG + Intronic
1193122865 X:77841789-77841811 TGCAGCTACTCAGGAGGCTGAGG - Intronic
1193127669 X:77886525-77886547 TGCGGCTACTCAGGAGGCTGAGG + Intronic
1195637466 X:107133820-107133842 CCCGGCTACTCAGGGTGCTGGGG + Intronic
1197954125 X:131928765-131928787 TCCAGCTACTCAGGATGCTGAGG - Intergenic
1199992788 X:152997687-152997709 TCCGGCTACTCAGGAGGCTGAGG - Intergenic
1201510241 Y:14751773-14751795 TTCAGCTACTCAGGATGCTGAGG - Intronic
1201664816 Y:16439005-16439027 TGCAGCTACTCAGGATACTGAGG - Intergenic
1201753844 Y:17465627-17465649 TGCAGCTACTCAGGAGGCTGAGG + Intergenic
1201847708 Y:18440358-18440380 TGCAGCTACTCAGGAGGCTGAGG - Intergenic