ID: 914993433

View in Genome Browser
Species Human (GRCh38)
Location 1:152517816-152517838
Sequence TGGAGGTACCACCACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914993433_914993440 5 Left 914993433 1:152517816-152517838 CCCTGATGGTGGTGGTACCTCCA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 914993440 1:152517844-152517866 ACATGCTGCTGAAACCCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 194
914993433_914993441 18 Left 914993433 1:152517816-152517838 CCCTGATGGTGGTGGTACCTCCA 0: 1
1: 0
2: 0
3: 14
4: 119
Right 914993441 1:152517857-152517879 ACCCAGCAGGTCAGCACACATGG 0: 1
1: 0
2: 2
3: 33
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914993433 Original CRISPR TGGAGGTACCACCACCATCA GGG (reversed) Intronic
904254665 1:29247291-29247313 TGGAAGTGCCACATCCATCATGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906689300 1:47782050-47782072 TGTAGTTACCAAAACCATCAGGG - Intronic
910070138 1:83203957-83203979 TGGAGGTGTCACTTCCATCATGG - Intergenic
912687433 1:111778435-111778457 TGTACGAACCTCCACCATCAAGG - Exonic
914993433 1:152517816-152517838 TGGAGGTACCACCACCATCAGGG - Intronic
915168615 1:153962712-153962734 TGGAGCTACCAGAAGCATCATGG - Exonic
915243349 1:154539694-154539716 TGGTGTTACCTCCACGATCAAGG + Intronic
915533698 1:156520391-156520413 TGGAGGGAGTAACACCATCACGG - Intergenic
917800247 1:178563272-178563294 TGCAGGTACCCCCACCACAAGGG - Intergenic
917902034 1:179552196-179552218 TAGAGGGACAACCACGATCAGGG - Intronic
918563553 1:185898503-185898525 TAGAAGTACCACCTACATCAAGG + Intronic
920440953 1:205980024-205980046 TGGGGGCACCACCATCATCAAGG - Intronic
920819490 1:209367068-209367090 TGAAGGTACCACCAGCATGAAGG + Intergenic
922782480 1:228264073-228264095 TAGGGTGACCACCACCATCAAGG - Intronic
1062926221 10:1317636-1317658 TGGATGCACCAGCAACATCAGGG - Intronic
1063203334 10:3806996-3807018 TGGAGGAAGCACCACCCTCAGGG + Intergenic
1066688578 10:38004340-38004362 TGGAGGTACCAGCATGATCCTGG + Intergenic
1067819605 10:49516806-49516828 TGCAGCAACCTCCACCATCAAGG - Exonic
1067982473 10:51102034-51102056 TGGAGTAAATACCACCATCATGG + Intronic
1072076682 10:91982148-91982170 TGCAGGTGCCGACACCATCATGG + Exonic
1072520622 10:96227105-96227127 GGGAGGGAGCACAACCATCAGGG + Intronic
1072740047 10:97903766-97903788 TGGAGGTGCCAACAGCATGAGGG - Intronic
1079100709 11:17540238-17540260 TGAAAGCATCACCACCATCAAGG + Intronic
1083132878 11:60642760-60642782 TGAAACTATCACCACCATCAAGG + Intergenic
1083309262 11:61776145-61776167 TCTAGGTACCACCCCCAACAGGG - Intronic
1088753761 11:112868041-112868063 TGGAGGTACAACGGCCATCTTGG + Intergenic
1088780013 11:113124956-113124978 TGGAGGTACCACCAGTGTGATGG - Intronic
1091074995 11:132607082-132607104 TGAAGTTACCAGCACCAGCAGGG + Intronic
1095161151 12:38917320-38917342 TGAAAGCACCACCACAATCAAGG - Intergenic
1099097145 12:78388872-78388894 TGGAGGCACCATAATCATCAGGG - Intergenic
1102178737 12:110895533-110895555 TGGTGGGACCACATCCATCATGG + Intronic
1102507318 12:113391916-113391938 TGGAGGGAACCCCACCCTCAGGG - Intergenic
1104193761 12:126510413-126510435 TGCAGCAACCTCCACCATCAAGG + Intergenic
1109197401 13:59393252-59393274 TGGAGGTACAGCAACCCTCAGGG - Intergenic
1118438376 14:65791438-65791460 TGGATGCACCACCACCATGTGGG + Intergenic
1118613994 14:67562767-67562789 TGGAGGAGCCACCCCCAGCAGGG + Exonic
1129901634 15:79156020-79156042 TGTAACCACCACCACCATCAAGG + Intergenic
1130625293 15:85507973-85507995 AGGAGGGACCTACACCATCAAGG - Intronic
1135827817 16:25745604-25745626 TGTAACTACCACAACCATCAGGG + Intronic
1145223494 17:21108096-21108118 TAGAGGTAACACCAGCATCTGGG - Intergenic
1146624003 17:34422329-34422351 TGCTGCTGCCACCACCATCAAGG + Intergenic
1149432896 17:56608578-56608600 TGGTAGCACCACCACCAGCATGG - Intergenic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1160189894 18:76707277-76707299 GGGACCTACGACCACCATCACGG + Intergenic
1162224227 19:9206240-9206262 CGGGGGGACCACCACCACCAAGG - Intergenic
1163414723 19:17179222-17179244 GGGCGGTACCATCCCCATCAGGG - Intronic
1168466256 19:56604209-56604231 TGGAACCATCACCACCATCAAGG - Intronic
1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG + Intergenic
927488055 2:23502731-23502753 TGGAGTGGCCACCAGCATCATGG - Intronic
934682956 2:96298711-96298733 AGCAGGTAACACCACCATTAAGG + Intronic
938640244 2:133270215-133270237 TGCAACTACCACCACAATCATGG - Intronic
938724728 2:134097297-134097319 AGGAGGTACCACCACTCTGAAGG + Intergenic
945712573 2:213317022-213317044 TCTAGGTACCAATACCATCATGG - Intronic
947765768 2:232636107-232636129 TGGCCATACCACCACCACCAAGG - Intronic
1171053915 20:21887559-21887581 TGAAGCTATCACCACCATTAAGG + Intergenic
1172038374 20:32026414-32026436 TGGAGCTACAACCACCATCTCGG - Intronic
1179196815 21:39171811-39171833 AGCAGGGACCACCAGCATCAGGG + Intergenic
1181669152 22:24418090-24418112 TGCAGGAAGCACCACCACCATGG - Intronic
1181862338 22:25828808-25828830 TGGAGAGTCCACCACCATGATGG - Exonic
1181989273 22:26824882-26824904 TGAAGCCATCACCACCATCAAGG - Intergenic
1184334762 22:43846668-43846690 AGGAAGTACCACCATCCTCATGG + Intronic
1184747102 22:46462365-46462387 TGGAGGGAAAACCACCAGCACGG - Intronic
1185191000 22:49435984-49436006 TGCCCGTACCTCCACCATCAGGG + Intronic
949506717 3:4735333-4735355 AGGAGGCAACACCACCATCCAGG + Exonic
952217797 3:31295129-31295151 TGGAGCCCCCACCACCCTCATGG + Intergenic
952348166 3:32508112-32508134 TGGAGCTACCATCTCCTTCATGG - Intergenic
952393216 3:32898636-32898658 TGAAGGTATCAACACCAACATGG - Intergenic
952611664 3:35216948-35216970 GGGAGGCATCACCACCGTCACGG - Intergenic
953410945 3:42690226-42690248 TGCAGCTGCCTCCACCATCAGGG - Intronic
958118879 3:89258871-89258893 TGGAGATACCACAACACTCAGGG - Intronic
961369498 3:126420692-126420714 TGGAGGGACCACCTCTCTCAGGG - Intronic
961655628 3:128440087-128440109 TGGAGGGACCACCTCTCTCATGG - Intergenic
961840008 3:129701833-129701855 TGGAGGTGGTACTACCATCATGG - Intronic
964460365 3:156918470-156918492 TGAAGCTTTCACCACCATCATGG + Intronic
964802119 3:160568038-160568060 GCGAGGCATCACCACCATCACGG + Intergenic
965139750 3:164818046-164818068 TGGAGGTACCACTAGAATCGAGG + Intergenic
967337126 3:188357036-188357058 TGCAACTACCACCACCACCATGG + Intronic
970271326 4:14351138-14351160 TGGAGGTGAGACCACCATGATGG - Intergenic
972191060 4:36591320-36591342 TGAAAGTATCACCACCATCAAGG - Intergenic
977845322 4:101760514-101760536 TGCAGGTTCCACCTCCCTCAGGG + Intronic
978429708 4:108620774-108620796 TGGAGGTGCCACCAGGAACAAGG - Intronic
982166861 4:152621240-152621262 TGGAGTTACAACCACCATTTTGG + Exonic
988622186 5:32834358-32834380 TGGTGGTACCAACACCTTCATGG + Intergenic
993334224 5:86637089-86637111 TTGTGGTACTACCACCATCACGG + Intergenic
995285073 5:110378640-110378662 TGGAAGTACCAAGACCATGAGGG - Intronic
996751119 5:126889807-126889829 AGGAGATACCACCTCCATCGTGG - Intronic
998571734 5:143265615-143265637 TGTAACTACCACCACAATCAAGG + Intergenic
1001260717 5:170226133-170226155 TGGAGAGAACATCACCATCATGG + Intergenic
1002660234 5:180786745-180786767 TGGGGGTTCCTCCACCGTCAGGG - Intergenic
1007668100 6:43528393-43528415 TTGAGATACCACCTTCATCAGGG - Intronic
1013488241 6:110618578-110618600 TTGAGGTCCCACCAGCATCTGGG + Intronic
1014818797 6:125962629-125962651 TGGAGTTACCAGCATCATGAGGG + Intronic
1015710010 6:136129381-136129403 TGGAGGTCCCAACCCCATGAGGG + Intronic
1017294777 6:152780681-152780703 TGGAGCTACCACCAAGATCTGGG + Intergenic
1017658706 6:156653585-156653607 TCTAGGTACCACCACCTTCTTGG + Intergenic
1019663451 7:2239163-2239185 CGCAGGTACCAGCACCAGCATGG - Intronic
1021013214 7:15497465-15497487 TGGAGGTACAAACATCATCAAGG + Intronic
1022197264 7:28081321-28081343 CGGAGGAACCAACACCAACATGG + Intronic
1023110222 7:36802702-36802724 AGGAGGTACCACCACCCACTGGG - Intergenic
1024281160 7:47721006-47721028 TGGACGTTCCCCCACCATGAAGG - Intronic
1026150169 7:67781461-67781483 TTGAGGAATCACCACTATCATGG + Intergenic
1026608112 7:71833295-71833317 TGGAGATAAAACCACCAACAGGG - Intronic
1026642356 7:72139021-72139043 TGGAGGTACCATCAACAAGAAGG - Intronic
1027287910 7:76669131-76669153 TGGAGGTGTCACTTCCATCATGG - Intergenic
1028943540 7:96552118-96552140 TGAATGTACTACCACCTTCATGG - Intronic
1029714537 7:102318760-102318782 AGGAGGTAGCACCTCCACCAGGG + Intronic
1031168309 7:118258589-118258611 TGGATGTACCACATCCATCTAGG - Intergenic
1033056571 7:138060232-138060254 TGGGGGTCACACCACCCTCAGGG - Intronic
1034794100 7:153996911-153996933 TGGAGTTACCCCCATCATGAAGG + Intronic
1035770079 8:2139995-2140017 TGCAGGCACCACCACCACCCAGG + Intronic
1042067113 8:64890386-64890408 TGGAGGTATTACCACCTTAAGGG - Intergenic
1045652609 8:104355192-104355214 TGGAGGTTACACCACCATCTTGG - Intronic
1046422875 8:114007763-114007785 TGCAGCTACCACCAATATCATGG + Intergenic
1047166016 8:122439198-122439220 TGGAGTTACCACCACAAAGAAGG - Intergenic
1049914805 9:306972-306994 TGAAGGTACCAGCACCAGCCGGG - Intronic
1050221916 9:3400810-3400832 TGGGGATAACACCTCCATCAGGG - Intronic
1057398196 9:94699315-94699337 TGAAGCAATCACCACCATCAAGG + Intergenic
1059493150 9:114686097-114686119 TGTAACTACCACCACAATCACGG + Intergenic
1060689345 9:125642829-125642851 TGGAGGTCCCACCAGCATTTGGG + Intronic
1061712885 9:132499641-132499663 TGGAGGTACCAGCTCAATCAGGG + Intronic
1062472910 9:136714017-136714039 TGGAGGTGGCCCCACCATCCAGG - Intronic
1188585834 X:31774089-31774111 AGCAGGTACCTCCAACATCAAGG + Exonic
1189893905 X:45633532-45633554 GGGAGGCATCACCACCATCATGG - Intergenic
1191683834 X:63868912-63868934 TGGAGATACCACAACCATGATGG - Intergenic
1192851653 X:74962797-74962819 TGTAACTACCATCACCATCAGGG + Intergenic
1193221050 X:78927613-78927635 TGTAGCTACCACCACAATCAGGG - Intergenic
1195095162 X:101494373-101494395 TGGGGATAACACCAGCATCAAGG + Exonic
1195495956 X:105533523-105533545 TGTAACTACCACCACAATCAAGG + Intronic
1196865359 X:120066125-120066147 TTCAGGTACCAACACCACCACGG + Intergenic
1196877734 X:120170155-120170177 TTCAGGTACCAACACCACCACGG - Intergenic
1200055911 X:153460814-153460836 TGGCCGTGCCACCACCATCACGG + Intronic
1200607872 Y:5289035-5289057 TGTAACTACCACCACAATCAAGG + Intronic
1201649484 Y:16269869-16269891 TAGCGGTACCACCAGCATCTGGG + Intergenic