ID: 914998519

View in Genome Browser
Species Human (GRCh38)
Location 1:152565803-152565825
Sequence ACTTTCACAGGCTGAGCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1187
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 1098}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914998519_914998527 13 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998527 1:152565839-152565861 ATGGGAAGGCATGCGTCAGATGG 0: 1
1: 0
2: 2
3: 9
4: 117
914998519_914998525 -5 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998525 1:152565821-152565843 AAAGTCAGAAGAGGGTATATGGG 0: 1
1: 0
2: 3
3: 19
4: 250
914998519_914998524 -6 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998524 1:152565820-152565842 GAAAGTCAGAAGAGGGTATATGG 0: 1
1: 0
2: 5
3: 24
4: 260
914998519_914998528 14 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998528 1:152565840-152565862 TGGGAAGGCATGCGTCAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 91
914998519_914998530 25 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 90
914998519_914998529 15 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998529 1:152565841-152565863 GGGAAGGCATGCGTCAGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 147
914998519_914998526 -1 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998526 1:152565825-152565847 TCAGAAGAGGGTATATGGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914998519 Original CRISPR ACTTTCACAGGCTGAGCTGG AGG (reversed) Exonic