ID: 914998523

View in Genome Browser
Species Human (GRCh38)
Location 1:152565815-152565837
Sequence TACCCTCTTCTGACTTTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 1, 2: 2, 3: 6, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914998523_914998527 1 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998527 1:152565839-152565861 ATGGGAAGGCATGCGTCAGATGG 0: 1
1: 0
2: 2
3: 9
4: 117
914998523_914998529 3 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998529 1:152565841-152565863 GGGAAGGCATGCGTCAGATGGGG 0: 1
1: 0
2: 0
3: 14
4: 147
914998523_914998532 22 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998532 1:152565860-152565882 GGGGCTGTTCTTGGCCTCTTGGG 0: 1
1: 0
2: 0
3: 27
4: 383
914998523_914998531 21 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998531 1:152565859-152565881 TGGGGCTGTTCTTGGCCTCTTGG 0: 1
1: 0
2: 0
3: 33
4: 318
914998523_914998528 2 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998528 1:152565840-152565862 TGGGAAGGCATGCGTCAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 91
914998523_914998530 13 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914998523 Original CRISPR TACCCTCTTCTGACTTTCAC AGG (reversed) Exonic