ID: 914998530

View in Genome Browser
Species Human (GRCh38)
Location 1:152565851-152565873
Sequence GCGTCAGATGGGGCTGTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914998519_914998530 25 Left 914998519 1:152565803-152565825 CCTCCAGCTCAGCCTGTGAAAGT 0: 1
1: 0
2: 6
3: 82
4: 1098
Right 914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 90
914998520_914998530 22 Left 914998520 1:152565806-152565828 CCAGCTCAGCCTGTGAAAGTCAG 0: 1
1: 0
2: 1
3: 25
4: 255
Right 914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 90
914998523_914998530 13 Left 914998523 1:152565815-152565837 CCTGTGAAAGTCAGAAGAGGGTA 0: 1
1: 1
2: 2
3: 6
4: 172
Right 914998530 1:152565851-152565873 GCGTCAGATGGGGCTGTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914998530 Original CRISPR GCGTCAGATGGGGCTGTTCT TGG Exonic