ID: 914998829

View in Genome Browser
Species Human (GRCh38)
Location 1:152568621-152568643
Sequence AACAGTATACAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914998829_914998835 11 Left 914998829 1:152568621-152568643 CCCTCCCCCTTCTGTATACTGTT 0: 1
1: 0
2: 0
3: 22
4: 264
Right 914998835 1:152568655-152568677 AATCATATCTTTACATTAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914998829 Original CRISPR AACAGTATACAGAAGGGGGA GGG (reversed) Intronic
903537910 1:24079499-24079521 GACAGTATAAAGAATGGAGATGG - Intronic
903566297 1:24268292-24268314 TAAAGTATACAGGAGGGGGCTGG - Intergenic
905269117 1:36775148-36775170 AACAGAAGAGACAAGGGGGAAGG - Intergenic
905772086 1:40644883-40644905 AAAAGGACACAGAAAGGGGAGGG + Intronic
909864871 1:80654595-80654617 AAGACAATACAGAAGGGGAATGG - Intergenic
911460498 1:98183024-98183046 TACAGTATACTGAAGGGTGAGGG - Intergenic
912059874 1:105654187-105654209 AATAGTACACACTAGGGGGAAGG + Intergenic
912190542 1:107334437-107334459 AACAGGGAACAGATGGGGGAAGG + Intronic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
914437741 1:147674840-147674862 CACAGTATACACAAGAGAGAGGG + Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915815351 1:158959825-158959847 AACAGAATACAAGAGGGGAAAGG + Intronic
917277151 1:173342878-173342900 AACATTATCTAGAAGGGAGAAGG + Intergenic
918021464 1:180696591-180696613 AACATCATACTGAAGGGGAAAGG - Intronic
918380893 1:183954044-183954066 AACAGTATTCAGAAGGAGCTTGG - Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
921137386 1:212273713-212273735 ATCAGTATACAGATAGGAGATGG - Intergenic
921778170 1:219127082-219127104 GTCACTATAAAGAAGGGGGAGGG - Intergenic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
924619094 1:245645005-245645027 AGCAGGAGAGAGAAGGGGGAAGG + Intronic
1065136628 10:22677254-22677276 TACAGTCTCCAGAAGGGGTAGGG - Intronic
1065333532 10:24630234-24630256 AACTATATACAAAAGAGGGACGG + Intronic
1066056324 10:31684260-31684282 AACAGGACAAAGGAGGGGGAAGG + Intergenic
1067006869 10:42672649-42672671 AGCAGGATACAGGAGGGTGATGG + Intergenic
1068624591 10:59227997-59228019 AACAGTATATAGAATTGGTAAGG + Intronic
1070363682 10:75715163-75715185 AAGAGAATACACAAGGGGAATGG - Intronic
1070780418 10:79134377-79134399 AACAGCATACAACAGTGGGATGG - Intronic
1073223894 10:101900041-101900063 AAAAGTAGACATAAGGGGAATGG - Intronic
1073667474 10:105550049-105550071 AACAGCACAAAGAAGGTGGATGG + Intergenic
1074310978 10:112323250-112323272 AACAGTATACACAAAGGGTTTGG + Intergenic
1074673304 10:115820430-115820452 ATCAGGATACAGAAAGGAGATGG + Intronic
1075369343 10:121921772-121921794 CACAGTTCACAGAAGGGGGTGGG - Intronic
1078114090 11:8427652-8427674 AACTTTATACAGAAGGGAGCAGG - Intronic
1078316153 11:10294473-10294495 AACAGAATAGAGAAGGCGGAAGG - Intergenic
1078822515 11:14895962-14895984 AAGAGGATGCAGAAGGGGAAAGG + Intergenic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1079403152 11:20122593-20122615 ATCAGCATACATAAAGGGGATGG + Intergenic
1082803375 11:57430845-57430867 CACAGTAGACAGGAAGGGGATGG + Intergenic
1083411966 11:62500050-62500072 AACAGAATAGAGAAGAGGGCAGG + Intronic
1083439804 11:62668514-62668536 AACAGTACACAGACGGGGCCGGG + Intronic
1083550579 11:63586432-63586454 AACAGAATAAAGAACGGGGCTGG - Intronic
1084044476 11:66560780-66560802 CACAGTATGCAGGAGGGGGTGGG - Intronic
1085523262 11:77150346-77150368 AACAGGATTCATAAGGGAGAGGG + Intronic
1085550537 11:77366476-77366498 AATAGAATAAAGAAGGGGCAGGG + Intronic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1087248129 11:95864262-95864284 AAGAGTATACAGGAGGGAAAAGG + Intronic
1088063770 11:105690162-105690184 TACAGCATCAAGAAGGGGGAAGG - Intronic
1088158695 11:106841937-106841959 AGCAGGGTACAGAAGGTGGAAGG - Intronic
1088559682 11:111100692-111100714 GACAGTATAAAGATGGGGGGAGG + Intergenic
1088889513 11:114033476-114033498 ACCATTATACAGCAGGGAGAGGG + Intergenic
1089710293 11:120309714-120309736 TATAGTATAAAGAAGGGCGAGGG + Intronic
1090269406 11:125375392-125375414 AACAGTAGAGAAAAGGGGGAAGG + Intronic
1090694673 11:129227105-129227127 AACAGTACAAAGGAAGGGGAAGG + Intronic
1091886100 12:4018203-4018225 AACAGTATCCTGAAGGGGCAGGG - Intergenic
1092164246 12:6333265-6333287 CACAGAATACAGGAGGGGGAAGG + Intronic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094158588 12:27364631-27364653 AACAGTATACAGAAGAACAATGG - Intronic
1094806546 12:34099862-34099884 AGCAGTATAGAGAAGAGGAAAGG + Intergenic
1095238752 12:39832015-39832037 AAGAGTTTACAGGAGGGAGAAGG - Intronic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1098178104 12:67814681-67814703 AACAGTATAGATAAGAAGGATGG - Intergenic
1101074472 12:101114289-101114311 AACAGTCTACAAAAGGTGAAAGG + Intronic
1101631849 12:106502567-106502589 AACAATGTAGAGAAGGGGCAAGG + Intronic
1101769383 12:107734836-107734858 AATAGTATACAGCAGTGGAAGGG - Intronic
1102585004 12:113916555-113916577 AGCAGCATACAGCAGAGGGATGG + Intronic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1103016701 12:117500232-117500254 ACCGGAATGCAGAAGGGGGATGG + Intronic
1104290662 12:127463854-127463876 AACAGGATACAGATGAGGGAAGG + Intergenic
1105369178 13:19787756-19787778 AACAGTTTCAAGAAGGGGGCAGG - Intergenic
1105714585 13:23049910-23049932 AACAATATACAGAAAGAGGTTGG + Intergenic
1107339353 13:39389403-39389425 AAACGTATAAAGAAGGGGTATGG + Intronic
1108136887 13:47374129-47374151 AACAGCACAAAGGAGGGGGAAGG - Intergenic
1109412791 13:61995340-61995362 AGCATGATACAGAAGGGGCAGGG - Intergenic
1109700484 13:66018587-66018609 AAAAGTAGACAGAAGAGTGAAGG - Intergenic
1114598330 14:23933508-23933530 AACAGAATACTGAGTGGGGAGGG + Intergenic
1118592943 14:67414453-67414475 AGCAGTAAACAGCTGGGGGAGGG + Intergenic
1119150115 14:72351370-72351392 AACAGAACAGAGAATGGGGATGG - Intronic
1120717497 14:87855405-87855427 ACAAGTATAAGGAAGGGGGAAGG + Intronic
1121039668 14:90735120-90735142 AACAGTATCCAGAACATGGAAGG + Intronic
1121582443 14:95040951-95040973 AACAGTGTTTGGAAGGGGGAGGG + Intergenic
1121899858 14:97684191-97684213 AACTTTGGACAGAAGGGGGAAGG - Intergenic
1123873838 15:24603759-24603781 AAAAGTAGACAGTAGGGGAAGGG + Intergenic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1126484871 15:49169111-49169133 ACATGTATACAGAAGGGGGAAGG + Intronic
1127630273 15:60821265-60821287 AACAGCACACAGCAGGGAGACGG - Intronic
1128914460 15:71547121-71547143 AACAGAAAGCAGAAAGGGGAGGG - Intronic
1129870223 15:78935210-78935232 ACCAGTAGACAGGAGAGGGAAGG - Intronic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133893735 16:9905740-9905762 AAAAATATATACAAGGGGGAGGG + Intronic
1135790544 16:25390377-25390399 AGCAGTATTGAGAAAGGGGAGGG + Intergenic
1137544306 16:49389719-49389741 AACAGCATGTAGAAGGGGAAAGG - Intronic
1139758540 16:69165366-69165388 AACAGTATACAGATTGGAGCCGG + Exonic
1141779978 16:86152886-86152908 CACAGGACACAGAACGGGGAAGG + Intergenic
1142749822 17:1980534-1980556 AACGCTATAAAGAAGTGGGAGGG - Intronic
1144711185 17:17402603-17402625 AACACTATGCAGAGGGAGGATGG + Intergenic
1145709581 17:26958835-26958857 AAAAGTAAAGAGGAGGGGGAGGG - Intergenic
1145938317 17:28727588-28727610 ATCAGTATTCAGGAGGAGGATGG - Intronic
1146585220 17:34076405-34076427 AACAGTAGAGTGAAGGGAGAGGG - Intronic
1149660696 17:58332667-58332689 GACAGGAAACAGAAGGGGGTGGG + Intergenic
1150575256 17:66425050-66425072 AACAGTATACAGGCTGGGCACGG - Intronic
1154518680 18:15201921-15201943 AAAAGTAAAGAGGAGGGGGAGGG + Intergenic
1157084222 18:44562029-44562051 ACCATAATACAGGAGGGGGAAGG - Intergenic
1157828263 18:50832236-50832258 AACAGCAAAGGGAAGGGGGAAGG - Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164584470 19:29458023-29458045 AACAGTATGGAGAGGTGGGATGG - Intergenic
1164791299 19:30985305-30985327 AACAGTAAACAGAAGACAGATGG - Intergenic
1165762643 19:38330727-38330749 TACATTTTACAGATGGGGGAAGG + Intergenic
1166086686 19:40480662-40480684 AACACTATACAGCAAGGAGAAGG - Intronic
1168057018 19:53869595-53869617 AACAGTTAACTGAACGGGGAGGG + Exonic
1168087660 19:54060265-54060287 AACAGAACACAGAAGAGGGAGGG - Intronic
1168133596 19:54336625-54336647 AACAGGACAGTGAAGGGGGAGGG - Intronic
1202682847 1_KI270712v1_random:25123-25145 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
925050022 2:806172-806194 AACATCACACAGAAAGGGGAAGG - Intergenic
925424680 2:3739255-3739277 TAAATGATACAGAAGGGGGAAGG + Intronic
928095084 2:28399551-28399573 AACAGGGTACAGCAGGGTGATGG + Intronic
928312448 2:30222111-30222133 AACAGTAAAAAGAAGGGGTAGGG - Intergenic
928910636 2:36417259-36417281 AACAGAAAACAGAAGAGGTATGG - Intronic
928920272 2:36519803-36519825 ACCAGCATACAAAAGGGAGAGGG + Intronic
929259953 2:39855038-39855060 AATCGTATCCAGAAAGGGGAAGG + Intergenic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
932766354 2:74472977-74472999 AGCAGGGTACAGAAGGGGAAAGG - Exonic
933349094 2:81129947-81129969 AACAGCATAAAGATGGGAGAGGG - Intergenic
933369302 2:81395062-81395084 AAGAAAATAAAGAAGGGGGAGGG + Intergenic
933441227 2:82316969-82316991 AACAGTATACACATGAGGAAGGG + Intergenic
933840579 2:86283004-86283026 AACCAGATAAAGAAGGGGGAAGG - Intronic
934248953 2:90330051-90330073 AAAAGTAAAGAGGAGGGGGAAGG + Intergenic
934260626 2:91473425-91473447 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
935174756 2:100640057-100640079 GGCAGTTGACAGAAGGGGGAAGG - Intergenic
935490145 2:103709493-103709515 AACAGTAAAAGGAAGGGGAAAGG + Intergenic
936118601 2:109722416-109722438 AACAGTACAGAGATGGGAGAGGG - Intergenic
937302230 2:120850101-120850123 AACAGAAAACAGACGGGAGAAGG + Intronic
937868110 2:126768979-126769001 AAAAGTAAACAGAAGAGGTAGGG + Intergenic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939919119 2:148086678-148086700 AACAGGATACAGAATAGGGGTGG + Intronic
940630429 2:156230748-156230770 AACAGTCTACCCAAAGGGGAAGG + Intergenic
942240669 2:173962243-173962265 ATCAGTTTACAGATGGGGGAGGG - Intronic
942812629 2:180016857-180016879 AACAGTTTACAGGAGAGAGAAGG + Intergenic
943591665 2:189805226-189805248 CACATAATAAAGAAGGGGGAGGG + Intronic
944455230 2:199886725-199886747 AACAATATAGAGAAGAGAGAAGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945155596 2:206834208-206834230 AACAGAATACAGATGTGGGAGGG - Intergenic
946102736 2:217340366-217340388 GACAGTATACACAAGGAAGAGGG - Intronic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
946349895 2:219143243-219143265 AACAGGACACAGAAGGGTCATGG - Intronic
1168919739 20:1521402-1521424 AGCATTATGCAGAAGGAGGATGG + Intergenic
1169842911 20:9959818-9959840 CACAGTCTACAAACGGGGGATGG - Intergenic
1170992721 20:21319707-21319729 AATAATATACAAAGGGGGGATGG - Intronic
1171962114 20:31502372-31502394 AAGAGGGTACAGAAAGGGGAGGG + Intergenic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1173256830 20:41399736-41399758 AACAGGATAAGGAAGGGGCAAGG - Intergenic
1174469360 20:50744702-50744724 GACAATATCCAGAAGAGGGAGGG - Intronic
1174822326 20:53737448-53737470 AACTCCATACAGAGGGGGGATGG + Intergenic
1180962808 22:19769983-19770005 AGCAGCTTACAGAAGGGGCAGGG - Intronic
1182363547 22:29762777-29762799 GACGGGATACAGGAGGGGGATGG - Intronic
1184284101 22:43457801-43457823 AATAGCATAAAGGAGGGGGAGGG - Intronic
949271533 3:2223354-2223376 ACCATGAAACAGAAGGGGGAAGG - Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
951088691 3:18545703-18545725 AACAGTATAGAGAATTGGTAGGG + Intergenic
951325426 3:21296967-21296989 AACCGTACACAGAAGGGGCTAGG - Intergenic
952225082 3:31366883-31366905 AGCAGCATACAGAATGGAGAGGG - Intergenic
952236962 3:31490139-31490161 AACAGTACAAAGAAGGTGGAAGG - Intergenic
952285089 3:31960699-31960721 AACAGTTTCCAGAGTGGGGAAGG - Intronic
953552784 3:43917411-43917433 AACAGCATATAGAAGGGTGGGGG - Intergenic
954832302 3:53432426-53432448 TACAGTATACAGCAGGGACAGGG - Intergenic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
955281721 3:57600438-57600460 AAAAGGGAACAGAAGGGGGAAGG - Intergenic
955803385 3:62708813-62708835 AACAGGATAAAGAAAGGGGTAGG + Intronic
958708200 3:97683744-97683766 AACCGAATACAGAAGGGCAAAGG - Intronic
959356719 3:105340580-105340602 AAAAGTATTTAGAAGGAGGAGGG - Intergenic
959369470 3:105504876-105504898 TAAATGATACAGAAGGGGGAAGG - Intronic
961193540 3:124982719-124982741 CACAGTTTTCAGAAGGGGGGTGG - Intronic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
962986357 3:140539844-140539866 AGCAGTATACATAGGGGCGAGGG - Intronic
964843578 3:161022277-161022299 AACAGCACAGAGAATGGGGAGGG - Intronic
965014945 3:163146112-163146134 AACATTATACTGATGGGGAAAGG - Intergenic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
968470289 4:778315-778337 AAATGTATACAGAATGGTGAAGG - Intergenic
968482362 4:840123-840145 AACAATATATAGAAGGTGGGGGG - Intergenic
969237558 4:5876743-5876765 ATCAGTTTTCAGAAGGGGGGTGG - Intronic
969328145 4:6455830-6455852 AGCAGTAGGCAGCAGGGGGAGGG - Intronic
970272730 4:14364693-14364715 AACAGTATACAGAAGAAAAATGG - Intergenic
970769061 4:19588238-19588260 AACAGAATACAGAAAGGGAGAGG + Intergenic
971518368 4:27516827-27516849 AAATGTGTACAGGAGGGGGAAGG + Intergenic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
975823644 4:78296753-78296775 AACACAAGACAGAAGGGGGAAGG - Intronic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976914163 4:90349547-90349569 AACAGTATATACAAGGTGAATGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
977892414 4:102327337-102327359 TACAGCATGCTGAAGGGGGAAGG - Intronic
981850708 4:149226827-149226849 AACAAAATACAGAAGTGGGATGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982872030 4:160592325-160592347 AACAGTATGTGGAAGAGGGATGG + Intergenic
983231149 4:165130070-165130092 TACAATATGCAGAAGTGGGAGGG - Intronic
983539568 4:168894730-168894752 AACAGTATCCATAAGGAAGATGG - Intronic
983768952 4:171523769-171523791 AACTGGAGACAGAAGTGGGAAGG + Intergenic
987467684 5:18291715-18291737 AAAAGAATACAGTAAGGGGAGGG + Intergenic
988650521 5:33144312-33144334 AACAGTATAGAGGAGGAGGTAGG + Intergenic
988744273 5:34117839-34117861 AACAGCACAAAGAATGGGGATGG - Intronic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989226094 5:39030792-39030814 AACAGTACTCAGGAGGAGGAGGG + Intronic
989630922 5:43482136-43482158 AACAGTAGACAGTAGGGGCCAGG - Intronic
990014960 5:51048965-51048987 AACAGTACACTGAAGGATGAAGG - Intergenic
990091934 5:52062483-52062505 AACAGTTTAGAGAAGGGAGGTGG + Intronic
990368424 5:55093138-55093160 AACTGAATTCACAAGGGGGAAGG - Intergenic
992200182 5:74375557-74375579 AACAGAAGATAAAAGGGGGAGGG + Intergenic
993252149 5:85542135-85542157 AGCAGTATTGAGAAGAGGGAAGG - Intergenic
996808491 5:127486183-127486205 AACAGTAAAAAAAAGGGGGAGGG - Intergenic
997594983 5:135101239-135101261 ATCAGCATTCAGAAGAGGGAGGG - Intronic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
1002438078 5:179245464-179245486 AACAGTACAAAGATGGGGGTGGG + Intronic
1004241043 6:13922967-13922989 AACTGAATACAGAACAGGGAGGG - Intergenic
1005223395 6:23614177-23614199 AACATCATACACAAGGGGGTGGG + Intergenic
1005569267 6:27128998-27129020 TACATTATACAGAAAGGGTAAGG - Intronic
1006101129 6:31687073-31687095 AACAGTGGTGAGAAGGGGGATGG + Exonic
1006847318 6:37071608-37071630 AACAGGATAGAGAAGGGTGTGGG + Intergenic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1008626917 6:53326102-53326124 CACAGTAGACAGAAAGGGTAGGG + Intronic
1008833381 6:55797187-55797209 AACATTCTACAGAATGGGGTTGG - Intronic
1009502342 6:64430760-64430782 AACAGAATGCAGAAAGGGGTGGG + Intronic
1009543696 6:64999446-64999468 TAAATGATACAGAAGGGGGAAGG + Intronic
1010205712 6:73321034-73321056 AAAAGAATACAGAATGGAGAAGG + Intergenic
1011051024 6:83149761-83149783 AACAGGATAAAGAAGGAGAAGGG + Intronic
1011335050 6:86250945-86250967 ACCAGAATGCAGAGGGGGGACGG - Intergenic
1011542935 6:88452145-88452167 AACACTATAAAGAAGGGCAAGGG - Intergenic
1015850540 6:137567532-137567554 AACAATTTACATAAGGGTGAGGG + Intergenic
1019226029 6:170510238-170510260 AACAGTGTGGAGAAGGGAGAGGG + Intergenic
1019384925 7:749474-749496 AACAGGAGAATGAAGGGGGAAGG - Intronic
1019834447 7:3368476-3368498 ATCAGTATGGAGTAGGGGGATGG + Intronic
1020153130 7:5699186-5699208 AAAATTATACTGAAGGAGGAGGG - Intronic
1020498585 7:8888295-8888317 AATAGTAAACAGAAGAGTGAAGG + Intergenic
1020674417 7:11164141-11164163 AACAGTAAAATGAAGGGAGACGG - Intronic
1022702556 7:32775491-32775513 AACAGTATATAGAATCTGGATGG - Intergenic
1023591455 7:41784754-41784776 AAAAGAATACAGTAAGGGGATGG + Intergenic
1024161209 7:46678375-46678397 TAAAGAATACTGAAGGGGGAAGG - Intronic
1025019209 7:55467472-55467494 AACTGTACACAGAAGGTGGCTGG - Intronic
1027367490 7:77473563-77473585 CACAGTACAGAGAAGAGGGAAGG + Intergenic
1028138769 7:87248821-87248843 TGCAGAATACAGAAGGGGAAAGG + Intergenic
1028192563 7:87869671-87869693 AATAGTATTCAGAAGTGGAAAGG - Intronic
1028371311 7:90095510-90095532 AACAGAAAACAAAAAGGGGATGG + Intergenic
1028980737 7:96965266-96965288 AATAGAATACAGAGGGGGAAAGG - Intergenic
1030480640 7:110099468-110099490 AACATTATACTGAATGGGGAAGG + Intergenic
1031145744 7:117995191-117995213 AAAAGTTTACTGAAGGGGCAGGG + Intergenic
1032199303 7:129808133-129808155 AAAAGAATAGAGAAGAGGGAAGG - Intergenic
1033046897 7:137970578-137970600 GACAGTTCACAGAAGGGGGTGGG + Intronic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1035380099 7:158432441-158432463 AACAGTGTTCAGGAGGGGGAGGG + Intronic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1037287417 8:17316407-17316429 AACTGTCAACAGTAGGGGGATGG - Intronic
1038186777 8:25282394-25282416 AACAGCATACAGCAGGTGAAAGG - Intronic
1039027722 8:33276115-33276137 GACAGAACACAGTAGGGGGATGG + Intergenic
1040680018 8:49797569-49797591 AAAAGAATACATCAGGGGGAGGG + Intergenic
1040687157 8:49888111-49888133 AACAGTAAACAGAAGAGAGCTGG - Intergenic
1042734591 8:71974193-71974215 AAAAGTAAAGAAAAGGGGGAGGG + Intronic
1044158250 8:88878166-88878188 ATCAGAATACAGAGGTGGGAAGG + Intergenic
1045421632 8:102022205-102022227 AACAGTATGGAAAAGGGGGAGGG + Intronic
1045665919 8:104484490-104484512 TACAGTATACAGAAGCTGCAAGG - Intergenic
1046164689 8:110416840-110416862 ACCAGCACACATAAGGGGGAGGG - Intergenic
1048680979 8:136841777-136841799 GAGAGTATAGAGGAGGGGGAGGG - Intergenic
1051146264 9:14030879-14030901 AACAGTTAACTGTAGGGGGATGG - Intergenic
1051997129 9:23231257-23231279 TTCAGAATACAGAAGGGCGATGG - Intergenic
1052617835 9:30865257-30865279 AAAAGTATACAGACCGGGGGTGG + Intergenic
1052746809 9:32449319-32449341 AACAGGGTACAGTAGGGGGTGGG - Intronic
1055864840 9:80800694-80800716 AAAAGTATCCAGAAGAAGGATGG - Intergenic
1061295581 9:129675153-129675175 TCCAGTATACAGGAGAGGGAGGG + Intronic
1186123996 X:6393097-6393119 AACAGTGTACAGAATTGGAAGGG - Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186228734 X:7429562-7429584 AAAAGGATAAAGAAGGTGGAGGG + Intergenic
1187090731 X:16093811-16093833 AACAGTAGTGAGGAGGGGGAAGG - Intergenic
1187485240 X:19697040-19697062 AACAGTATACTGAAGAGTGTCGG - Intronic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1190150151 X:47939152-47939174 AACACTACACTGAAGGGGGTGGG + Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1196281508 X:113828472-113828494 AGCAGGAGACAGAAGGGAGATGG - Intergenic
1196979489 X:121195807-121195829 ACCATTATACTGAAGGGGGCTGG + Intergenic
1199782084 X:151070861-151070883 AGCAGGTTACAGAAGGGTGAAGG + Intergenic
1199904266 X:152208435-152208457 GACAGTAGACAGTAGGGGCAGGG + Intronic