ID: 914999727

View in Genome Browser
Species Human (GRCh38)
Location 1:152578390-152578412
Sequence CTTCAGAGAGAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 628}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914999727_914999731 -5 Left 914999727 1:152578390-152578412 CCCTCCACCTTCTCTCTCTGAAG 0: 1
1: 0
2: 4
3: 56
4: 628
Right 914999731 1:152578408-152578430 TGAAGATTTAATTGTGTATGTGG 0: 1
1: 0
2: 1
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914999727 Original CRISPR CTTCAGAGAGAGAAGGTGGA GGG (reversed) Intronic
900809029 1:4787218-4787240 CTACAGTGGGAGGAGGTGGATGG + Exonic
900924728 1:5697577-5697599 CTTCACAGAGTGAAGGCGGAAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901672490 1:10864137-10864159 CTTAAAAGAGAAAAGGAGGAGGG - Intergenic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902454710 1:16524363-16524385 CTTCAGAGAGTTAAGAGGGAGGG + Intergenic
902802898 1:18841504-18841526 CTTCAGAGAGGGAGGGAGAAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903363642 1:22792813-22792835 CTACAGACAGTGAAGGTGCAGGG + Intronic
903688754 1:25153995-25154017 GGTCAGAGAGATGAGGTGGAAGG - Intergenic
903884019 1:26530725-26530747 CTTCTGAGAGAGAAGGAGCTGGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904009272 1:27380691-27380713 CCTCAGAGAGGGAAGGAGCAGGG + Intronic
904016615 1:27426328-27426350 GATCAGAGAAAGAAGGTAGAGGG + Intronic
904421822 1:30399006-30399028 CTGCAGAGAGAGATGGGGGTGGG + Intergenic
904755299 1:32765619-32765641 CTCCAGACAGAGGAGGGGGAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905366754 1:37455875-37455897 CTTCATAAAGAGAATTTGGAGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907239798 1:53075103-53075125 GTTCAGAGAGAGAAGGGGCTGGG - Intronic
907785910 1:57612470-57612492 AGTCAGAGAGAGAAGATGTAAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908482864 1:64559699-64559721 CTTCAGAAAGTAAAGGAGGAAGG - Intronic
909009458 1:70318330-70318352 CTTCAGTCGGAGAAGGAGGAAGG - Intronic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909318151 1:74248947-74248969 CTTCAGAGAGGCAAAGGGGAAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
911007953 1:93247521-93247543 CTTCAGAGACTTGAGGTGGAGGG - Intronic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
911971395 1:104442213-104442235 CATCACAGAAAGAAGTTGGAAGG + Intergenic
912023643 1:105138973-105138995 CTTGAGAGACAGCAGGTAGATGG - Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912647045 1:111403024-111403046 CTGCAGAGAAAAAAGGTGGCTGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913372987 1:118121203-118121225 CATCAGAGAGGGTGGGTGGAGGG + Intronic
914704163 1:150157884-150157906 CTTCAGAGAGAGAGGCAGGCAGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915002898 1:152609740-152609762 CTACTGAGGAAGAAGGTGGAGGG - Intergenic
915297481 1:154931368-154931390 CTTCAGAAAGGGAACTTGGAAGG - Intronic
915545385 1:156594076-156594098 CTGCAGTGAGGGAAGGTGGGTGG + Exonic
916014787 1:160740340-160740362 CTTGAGGGAGATAAGGTGGAGGG + Intronic
916052693 1:161047574-161047596 AGTCAAAGAGAGAAGCTGGAGGG + Exonic
916138959 1:161676927-161676949 CTTCAGGGAGAGAAGGCTGAGGG - Intronic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
916692351 1:167202437-167202459 CTTGACAGAGGGGAGGTGGATGG - Intergenic
916796538 1:168172623-168172645 CATCAGAGAGAGAAGGAGCTGGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917641089 1:176983778-176983800 CTTGAGAGAGAGAAAGAGGCTGG - Intronic
917717691 1:177754601-177754623 TTCATGAGAGAGAAGGTGGAGGG + Intergenic
918078702 1:181189959-181189981 CAAAAGGGAGAGAAGGTGGAAGG - Intergenic
918221163 1:182437992-182438014 CTCCAGAGAGAGATGGTGTAGGG + Intergenic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
919667308 1:200304334-200304356 CCTCAGAGAGAGAATGTGCCAGG - Intergenic
919780620 1:201218522-201218544 GTTCACAGAGAGGAGGTGGACGG + Exonic
920259967 1:204682681-204682703 CTTCAGACAGAGAAGGGGGAAGG - Intronic
920340595 1:205272958-205272980 CTTCAGAGAGAGGATGGGGCAGG - Exonic
920577393 1:207071608-207071630 CTTCAGAGACTCAAGGTGGCAGG - Intronic
920673223 1:208020670-208020692 TTTCAGAGAGAAGAGGAGGATGG + Intergenic
920703706 1:208236489-208236511 TTTAAGGGAGAGAGGGTGGAAGG - Intronic
922073526 1:222219977-222219999 GTGTTGAGAGAGAAGGTGGAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922469790 1:225868952-225868974 CTACAGAGGGAGAAGGGGCAGGG + Intronic
922866441 1:228864961-228864983 CTTCTGTGGGAGAAGATGGAAGG + Intergenic
923371015 1:233312601-233312623 CTTCATACAGAGAATTTGGAAGG - Intergenic
924587830 1:245375454-245375476 AACCAGAGAGAGGAGGTGGAAGG + Intronic
924643969 1:245860063-245860085 TGTCACAGAGGGAAGGTGGAAGG - Intronic
924767237 1:247045460-247045482 AGTCAGAGAGAGGAGGAGGAAGG - Intronic
1062790140 10:298452-298474 CTCCAGAGAGGGCATGTGGAAGG - Intronic
1062821795 10:540499-540521 TTTCAGTGAGAGAAGGGGCAAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063798787 10:9546189-9546211 CATCAGAGAGAAAAGCTGAAGGG + Intergenic
1064005798 10:11697988-11698010 CTTAGGAGGGAAAAGGTGGAAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064131779 10:12716149-12716171 CTTCAGAGAGATAAAGTGCGAGG - Intronic
1064300342 10:14117650-14117672 TGTGGGAGAGAGAAGGTGGAAGG + Intronic
1064957351 10:20925448-20925470 GTCAAGAGAGAGAAGGTGAAGGG - Intronic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1067225932 10:44375590-44375612 CTTCTAAGAGAGGAAGTGGAGGG + Intronic
1067497238 10:46772482-46772504 CATCTGAAAGAGAAGGTTGATGG + Intergenic
1067597414 10:47567933-47567955 CATCTGAAAGAGAAGGTTGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070843364 10:79503328-79503350 GGAGAGAGAGAGAAGGTGGAGGG - Intergenic
1070930297 10:80256270-80256292 GGAGAGAGAGAGAAGGTGGAAGG + Intergenic
1071199942 10:83209917-83209939 CTTCAGGCAGAAAAGGGGGAAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1072922216 10:99585777-99585799 CTTCATAGAGTGAGGGTGAAGGG + Intergenic
1073148285 10:101294636-101294658 CTCCAGAGAGACCAGGTAGAAGG + Intergenic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1073663547 10:105504803-105504825 CTTGACAGAGAGGAGGTGAATGG + Intergenic
1073751842 10:106537919-106537941 CTACAGGGAGAGAAGCTGGTGGG + Intergenic
1074047003 10:109848404-109848426 ATTTAGGGAGAAAAGGTGGAAGG - Intergenic
1074100444 10:110350333-110350355 ATTCACAGAGACCAGGTGGATGG - Intergenic
1076542025 10:131220556-131220578 GTTCAGAGAGGGAGGGAGGAAGG + Intronic
1076579121 10:131495078-131495100 CTTTATGGAGAGAAGGTGTATGG + Intergenic
1077060202 11:614532-614554 CTTCTGAGAGAGAATGGGGCAGG + Exonic
1077507508 11:2937613-2937635 ATTCAGAGACAGAAGGTAGGAGG + Intergenic
1077721953 11:4638449-4638471 CACCAGGGAGAGTAGGTGGAGGG + Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078452842 11:11453142-11453164 CTTGAGTCAGGGAAGGTGGAAGG + Intronic
1078643568 11:13118007-13118029 CTTCAGAAAGAGAAGGCAAATGG - Intergenic
1078660818 11:13284017-13284039 CTTCAGGGAGAAAAGGACGAAGG - Intronic
1079698835 11:23518946-23518968 CTGCTGAGAGAGAAGGAGAAAGG + Intergenic
1080617822 11:33960291-33960313 CTTCATAAAGAGAAGGGAGAGGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080807532 11:35668099-35668121 CTGGAGAGAGTGAAGGGGGAAGG + Intronic
1081993674 11:47350663-47350685 CTCAGGAGAGAGAGGGTGGAGGG - Intronic
1082059873 11:47850726-47850748 CTGCAGAGAGTGGAGGTCGAGGG - Intergenic
1082091842 11:48096713-48096735 CTTTAGAGAGACAATGTGGAAGG - Intronic
1082902977 11:58276300-58276322 CTTCACAGAGAGAAGCTTCATGG + Intergenic
1083245464 11:61423914-61423936 GTTCTGATAGAGAAGGGGGAAGG + Intronic
1083339370 11:61949137-61949159 TTTCAGAGAGAGAGGGTGACAGG + Intergenic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1084365327 11:68693779-68693801 CTTCCCAGAGAGAACGTGGTTGG + Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084483104 11:69433356-69433378 CTTCAGAGAGAGGACATGAATGG - Intergenic
1084534147 11:69746922-69746944 AAGCAGAGAGGGAAGGTGGAGGG - Intergenic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1084778572 11:71394023-71394045 CTGCAGTGAGAGAAGGCAGAGGG + Intergenic
1085314897 11:75538863-75538885 CTTGAGAGAGAACAGGAGGAAGG + Intergenic
1085364928 11:75931774-75931796 AGTGAGAGAGAGAAGGTGGCAGG - Intronic
1085444345 11:76590491-76590513 CTTGTGAGAAAGAAGGTGGGGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086330514 11:85749424-85749446 CTTCAGGCAGAGAATGTGAATGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086925798 11:92639514-92639536 CCTCAGAGAGAGATGGGGCATGG - Intronic
1087219550 11:95531588-95531610 CTTGAGGGAGAGAAGTTGGGGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087779306 11:102286289-102286311 CTTCAGGGAAGGAAGGTGGATGG - Intergenic
1088421771 11:109656486-109656508 TTTCCGAGAGAGAAGGCAGAAGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089154191 11:116387986-116388008 ATCCAGAGAGAGTAGGTGGCTGG - Intergenic
1089541113 11:119189438-119189460 ATACAGAGAGAGGAGGTAGAAGG - Intronic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089652734 11:119925114-119925136 CTTCAGAGAGAAAAGGAGGCAGG - Intergenic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1090197478 11:124828982-124829004 CTCCAGGGAGGGAAGGTGGTGGG + Intergenic
1090231340 11:125107643-125107665 CCTCAGTGAGAGGAGGTGAAGGG + Intronic
1090331567 11:125936391-125936413 CCACAGAGACAGAAGGTAGAAGG - Intergenic
1090359657 11:126163538-126163560 CTGCAGAGAGAGTAGGCAGAGGG + Intergenic
1090364275 11:126192953-126192975 CTACAGAGAAAGTGGGTGGATGG + Intergenic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1090655040 11:128836586-128836608 CTTAAGAGAGAAAAGGTAGAAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092532203 12:9353920-9353942 ACTCAGAAAGAGAAGGAGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093873102 12:24316214-24316236 CTTTAGAGAAAGCAGGTGGGTGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094261099 12:28500825-28500847 CTTCAGAGATAATAGGGGGAGGG - Intronic
1095698852 12:45170563-45170585 CTTCAGAGAGAAAGAATGGAAGG + Intergenic
1096077222 12:48813495-48813517 TTTCAGGCAGAGAATGTGGAGGG + Intergenic
1096183262 12:49562825-49562847 TTCCAGAGAGAGAAAGTGGCTGG - Intronic
1096636682 12:52964850-52964872 CTTCAGAGAAGGAAGGGGCAGGG + Intergenic
1097100056 12:56581376-56581398 CTGCCGAGAGAGAAGGCAGATGG - Intronic
1097513223 12:60568930-60568952 AGACAGATAGAGAAGGTGGAGGG - Intergenic
1097555310 12:61128929-61128951 CTTCAGAGACAGAAAGTGTCTGG + Intergenic
1097861250 12:64520964-64520986 CTACAGAGAGAGAAGGTGAATGG + Intergenic
1098302520 12:69068823-69068845 CCTGGGAGAGAGATGGTGGAGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099596620 12:84674312-84674334 CTTCAGAGAGAGAAATTTTATGG - Intergenic
1099860233 12:88217403-88217425 TTTCAGAGAGTGGAGGTGGGAGG - Intergenic
1099922542 12:88977445-88977467 CTCCAGAGAGGAAAGGGGGAGGG - Intergenic
1100265073 12:92968040-92968062 TGACAGAGAGAGAAGGTGCAAGG + Intergenic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1101044435 12:100790078-100790100 CTCCAGGGAGAGAAGCAGGAAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102172316 12:110851712-110851734 TTTCAGAGGGCGAAGGTGCAGGG - Intronic
1102435622 12:112920944-112920966 CTTTAGAGAGAGAAGGATTAGGG - Intronic
1103230367 12:119325373-119325395 CTTCAGAGAGAGAGAGAGTATGG - Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103739389 12:123081208-123081230 CTAAAAGGAGAGAAGGTGGATGG + Intronic
1104558823 12:129825557-129825579 CTTGGGAGAGTGCAGGTGGAGGG - Intronic
1104984879 12:132591203-132591225 GTGCCGAGAGCGAAGGTGGAGGG - Intergenic
1105419281 13:20238475-20238497 CTTCAGAGAGGGAAGCTCTAGGG + Intergenic
1107664494 13:42674895-42674917 CCTCAGTGAGAGCAGGTGGAAGG - Intergenic
1108313521 13:49217977-49217999 CTTCAGAGAAACAGGGTGCAAGG + Intergenic
1108556513 13:51598543-51598565 ATTCAGGAAGAGAAGGTAGAGGG - Intronic
1108794982 13:54019806-54019828 CTTCTGGGAAAGAAGCTGGAAGG + Intergenic
1109546599 13:63841902-63841924 CGTCAGAGAGACAAGATGGCAGG + Intergenic
1110755049 13:79162519-79162541 GTTCAAAGAGAGGAGATGGAGGG - Intergenic
1111899105 13:94179327-94179349 TTTGAGATAGAGAGGGTGGATGG + Intronic
1113651850 13:112039120-112039142 CTCCTGACAGAGAAGTTGGATGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114647256 14:24262727-24262749 CTGCAGAGCTAGCAGGTGGACGG - Intronic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1114862273 14:26538855-26538877 CTTCAGAAAGAGAATGTGGCAGG - Intronic
1115441938 14:33445848-33445870 CTCCAGAGAAAGAAGGTTGGTGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116041553 14:39692362-39692384 TTTAAGAGAGAACAGGTGGAGGG - Intergenic
1116984733 14:51206513-51206535 CTTCAGAGAGGGAAGAGGGCTGG - Intergenic
1117365250 14:55020970-55020992 CTTCACAGTGAGAAGGCTGACGG + Intronic
1118185066 14:63530028-63530050 CTATAGAGAGAGAACGTGAATGG + Intronic
1118580695 14:67294226-67294248 CTTCAGTGATAGAACGTGAATGG + Intronic
1119568312 14:75647452-75647474 CTTCTGAGAGATAAGAGGGAAGG + Exonic
1119711820 14:76828024-76828046 CCTCAGACAGGGAAGGGGGAAGG + Intronic
1120359120 14:83474108-83474130 CTGCAGAGAGATAAGATGGCTGG + Intergenic
1120924852 14:89787755-89787777 CTGCAGAGAGAACAGGGGGAGGG + Intergenic
1121371827 14:93365801-93365823 TTTCAGATAGAGAAAATGGAAGG + Intronic
1121639275 14:95474498-95474520 CTTCCCAGACAGAAGGTGAAGGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122865012 14:104599765-104599787 CTCCAGAGAGAGAATGGAGAAGG + Intronic
1123626312 15:22229169-22229191 CTACAGGGACAGAAAGTGGATGG + Intergenic
1123689440 15:22824447-22824469 CATCAGAGAGAGATGGTGCCAGG - Exonic
1124828648 15:33126234-33126256 CTTCAGAGAAGGAAGATGGGTGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127507102 15:59608049-59608071 CTTCAGAGACAGTGGGTGGGAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1129293801 15:74588388-74588410 CTTTAGGGAAAGAAGGCGGATGG + Intronic
1130784900 15:87085249-87085271 GATGAGAGAGAGAAGATGGATGG - Intergenic
1130784904 15:87085287-87085309 GATGAGAGAGAGAAGATGGATGG - Intergenic
1130846750 15:87754876-87754898 ATGCACAGAGGGAAGGTGGAAGG - Intergenic
1131105478 15:89731287-89731309 CTTCATAAAGAGAAGGATGATGG + Intronic
1132573578 16:654853-654875 CTTCAGGATGAGAAGATGGAGGG + Intronic
1133734235 16:8601951-8601973 GGTCAGAAAGAGAAGATGGAAGG - Intergenic
1133875014 16:9725822-9725844 GTTCAGAGAGAGATGGAGGTGGG - Intergenic
1133912700 16:10080377-10080399 TTGCAGAAAGCGAAGGTGGAAGG + Intronic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1135833514 16:25800438-25800460 CATCAGAGAGAGAAAGAGGTGGG - Intronic
1136004904 16:27322729-27322751 ATTAGAAGAGAGAAGGTGGATGG - Intronic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1136377241 16:29872744-29872766 CTGCAGGGAGAGGAGGGGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136608548 16:31352674-31352696 CTACAGAGAGAGAAGATGGAGGG - Intergenic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138786489 16:59852527-59852549 GCTCTGAGAGAGAAGGTGGGAGG + Intergenic
1138925885 16:61590906-61590928 ATTCAAAGAGCCAAGGTGGATGG - Intergenic
1139141211 16:64264763-64264785 CTACAGATAGAGAAGGTGGCAGG + Intergenic
1139404363 16:66706573-66706595 CCATGGAGAGAGAAGGTGGAGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139801017 16:69522840-69522862 GTTCAGAGAGTGAATGAGGAAGG - Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1141188760 16:81808368-81808390 TTTTAGAGAGAGAGGGAGGAGGG + Intronic
1141683070 16:85555334-85555356 ACTCAGAGAGAGGGGGTGGAAGG - Intergenic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1141977664 16:87528202-87528224 CTACAGGGACAGAAAGTGGATGG - Intergenic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1142291814 16:89196530-89196552 CTCCAGAGTGAGCAGGGGGAAGG + Intronic
1142602199 17:1059129-1059151 CGTCAGGTAGAGAAGGTGGTTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143162115 17:4878637-4878659 CAGCAGTGAGAGCAGGTGGAAGG + Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144028499 17:11299707-11299729 AGTCAGAGAGAGAAGGTGATGGG - Intronic
1144129780 17:12235110-12235132 CTTAAGAGAGAAAAATTGGATGG + Intergenic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1145119142 17:20240967-20240989 CTTCAGCAAGAGAAGGTGACAGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145989857 17:29072796-29072818 CTACAGAATGAGAAGGTAGAAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146622069 17:34406462-34406484 CGTCAGAGAGAGAAGGTTGAAGG - Intergenic
1147238132 17:39072486-39072508 CTTCAAAGAGAGAAGACAGAAGG + Intronic
1147816399 17:43213805-43213827 CTAGAGAGAGAGAAGGTGAGAGG - Intronic
1150033163 17:61763099-61763121 ATTCAGAGATAGAAAGTAGAAGG - Intronic
1151973519 17:77471300-77471322 CTTCAGAGACAGCAGGGGGCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153112299 18:1606293-1606315 CTTCAGGGGGCCAAGGTGGATGG - Intergenic
1153457049 18:5294501-5294523 CTTGAGAGAGAGAGGGGAGAGGG - Intronic
1154156923 18:11951114-11951136 CTTCAGAGAGGGAGGCGGGAGGG + Intergenic
1156267440 18:35501356-35501378 GTCCAGAGAGAGATGGTGGCTGG - Intergenic
1156828135 18:41457910-41457932 CTTCAGTCAGAGCAGGTGCACGG + Intergenic
1156941361 18:42770390-42770412 CTGCAGTGAGAGAAAGTTGATGG + Intronic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1158143513 18:54283510-54283532 CTTGAGAGAGAGAGAATGGAAGG - Intronic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1160140482 18:76317387-76317409 CTCCACAGAGAGTAGGTGGCTGG - Intergenic
1160232992 18:77062666-77062688 CTTCACAGAGACGAGGAGGAAGG + Intronic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1161268251 19:3375123-3375145 ATTCAGAGAGAGAGGGGGGTTGG + Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161483892 19:4524606-4524628 GTTCAGGGAGAGAATGTGGAGGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163347738 19:16754552-16754574 CTTTAGAGAGAATGGGTGGAAGG - Intronic
1163564343 19:18041080-18041102 CTGCAGTGAAGGAAGGTGGATGG + Intergenic
1163992073 19:21008147-21008169 CTACAGAGATAGGAGGTGAAGGG + Intergenic
1164147075 19:22518670-22518692 CTACAGTGAGAGAAAGTGGCAGG - Intronic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165009357 19:32832666-32832688 CTTTGGAGAGCCAAGGTGGAAGG + Intronic
1165132036 19:33638896-33638918 CTTGAGGGAGAGGATGTGGATGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166529232 19:43532807-43532829 CTTCCGAGGGGGAAGGTAGATGG + Intronic
1166557060 19:43707285-43707307 GTTCAGAGAGAGAGGGTGGGAGG - Intergenic
1166577419 19:43855433-43855455 CTTCAAAGAAAGCAAGTGGAAGG - Intergenic
1166790453 19:45395917-45395939 GGTGAGAGAGGGAAGGTGGAGGG + Intronic
1167106320 19:47431883-47431905 TTTCATAGAGAGAAGGTGGCAGG - Intronic
1167790450 19:51675407-51675429 TAACAGAGAGTGAAGGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168637033 19:58004253-58004275 CATGAGAGAGGTAAGGTGGAAGG + Intronic
925166678 2:1719895-1719917 ATTCAGAGAGAGAGGGAGGGAGG + Intronic
925387626 2:3473167-3473189 CTGCAGAGAGAGCAGGTGAGGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925686776 2:6481260-6481282 CTTCAGAGAGCAGATGTGGATGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926696187 2:15771417-15771439 CCTCAGGGAGAGGAGGTGAAGGG + Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927521978 2:23704344-23704366 CTGCAGGCAGAGAAGGTAGAGGG + Intronic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928103422 2:28452567-28452589 CTGCAGAGAGTGGAGGTGGGAGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929241751 2:39660610-39660632 CAGCAGAGAGAGAAGTTTGAAGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929997632 2:46838817-46838839 CTTCTGAGAGAGAGGATGCATGG + Intronic
931484199 2:62673791-62673813 CTTCAGTGATACATGGTGGAGGG - Intergenic
931661517 2:64568518-64568540 CTTCTGAGAAAAAAGGTAGATGG + Intronic
932208244 2:69903175-69903197 CTTCAGGGTAAGAAGGTGGATGG + Exonic
932330039 2:70893471-70893493 CTTCACAGAGTGAAATTGGAGGG + Intergenic
932401975 2:71486872-71486894 CTTCTCAGAGAGAAGCTGAAGGG + Intronic
932407354 2:71522325-71522347 CTTCAGGGAGGGGAGGTGGTGGG - Intronic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936097935 2:109548117-109548139 GTTCAGAGAGACAAGGTCCAAGG + Intronic
936344625 2:111665888-111665910 CATCACAGAAGGAAGGTGGAAGG - Intergenic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938555623 2:132421184-132421206 CTTCAGAAAGAGAAGATGGGAGG - Intronic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939462685 2:142517080-142517102 CATAAGTGAGAGCAGGTGGATGG + Intergenic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
943174998 2:184460881-184460903 TTTCAGAGAGAGAAAGAGGAAGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945178102 2:207064027-207064049 CCTTAGAGAGAGATGGGGGACGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945698713 2:213142865-213142887 CTAGAGCGAGAGAAGGTAGAGGG - Intronic
945834426 2:214822085-214822107 GGTCAGAGAGAGAGGGTGGTTGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946285384 2:218698777-218698799 CAGCAGAGAGAGAAGGTCGGAGG - Exonic
946329303 2:219000705-219000727 GCACAGAGAGAGAAGGGGGAGGG - Intergenic
946559399 2:220896067-220896089 CTTCATATAGAGAAGGTGGTAGG + Intergenic
946683183 2:222239336-222239358 TTTCAGAGAGAGAAGGAGGGGGG + Intronic
947148002 2:227086280-227086302 CTCCAGAGAGAGGAGATGTAGGG + Intronic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
948938278 2:241182549-241182571 CTTCTGAGTGGGAAGGAGGAGGG + Intronic
1168872958 20:1146588-1146610 CTTCAGAGCGATATGGAGGAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169321267 20:4635083-4635105 TTTCAGAGGGAGCAGGTGCAGGG - Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1169421829 20:5466601-5466623 CTTGAGACTGAGAAGGTGCAGGG - Intergenic
1169589471 20:7124234-7124256 CTTATGAGAGAGGAGCTGGAAGG + Intergenic
1170184763 20:13576192-13576214 ATTCCGAGACAGAAGGGGGAGGG + Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1172134994 20:32680908-32680930 CATCAGAGAGGGAAAGAGGAAGG - Intergenic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1173965804 20:47111778-47111800 CTTCAGAGGGTGAAGATGTAAGG + Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1176717394 21:10364605-10364627 CTTCAGAGAGAGAAGCTTCCAGG - Intergenic
1177198825 21:17930805-17930827 CTTCATAGAGAGAGGGGGAATGG - Intronic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178512588 21:33218267-33218289 AGTCAGAGAAAGAAGATGGAAGG - Intergenic
1178585939 21:33870868-33870890 CTTGAGAGACAGCAGGTAGATGG + Intronic
1178749175 21:35284224-35284246 GTTCAGAGAGAGGAGGGGGCAGG - Intronic
1179434155 21:41348710-41348732 ATTCAGAGAGAAAAGGTGAGTGG + Exonic
1180600949 22:17015388-17015410 CTTCAGAGAGAGAAGCTTTCAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181841913 22:25670626-25670648 ATTCAGGGAGAGAGGGAGGAAGG - Intronic
1182043828 22:27259120-27259142 CAACAGAGAGAGAAGGGAGAAGG - Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182680731 22:32077423-32077445 CTTAAAAGAGAGTAGGGGGAAGG - Intronic
1182834028 22:33326914-33326936 CTCCAGAGAGAGGGGGTGAAGGG - Intronic
1183087217 22:35493802-35493824 CTTCTGAGAGAGAGGGAAGAAGG - Intergenic
1183590175 22:38775450-38775472 AGTCAGTGTGAGAAGGTGGAGGG - Intronic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184454393 22:44600938-44600960 CCCCAGAGAGAGGAGGTGGCCGG - Intergenic
1185391612 22:50564481-50564503 CTTCCGAGAGAGTAGGAGAAAGG + Intergenic
950298517 3:11853119-11853141 ACACTGAGAGAGAAGGTGGAGGG - Intergenic
951576863 3:24123154-24123176 ATTCAGAGATGGAAGGGGGAAGG + Intronic
951805519 3:26639920-26639942 CTTCATAGACAGAAGGTTCAGGG + Intronic
952234086 3:31461149-31461171 AGTCAGAGAGAGAAGATGTAAGG + Intergenic
953353348 3:42232734-42232756 CCTCAGAGAGAGATGTTGGTTGG + Intergenic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954287441 3:49629125-49629147 CTACAGAGAGAAAAGGAGAATGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954428690 3:50457727-50457749 CTTCATATATAAAAGGTGGAGGG - Intronic
955412131 3:58662564-58662586 CTTTAGAGAGAGTAAGTGGCTGG + Intronic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955655896 3:61244567-61244589 CTTCAGAGAGGGCAGAAGGAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956715565 3:72076796-72076818 AATCAGAGAGAGAAGATGTAAGG - Intergenic
956809105 3:72847330-72847352 CTTCAGAAAGATTAGGAGGATGG + Intronic
957390332 3:79558200-79558222 CTTGAGGTAGAGAAGTTGGAAGG - Intronic
958906569 3:99948513-99948535 CTTCAGCCTGAGAAGGGGGAGGG + Intronic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959428737 3:106224958-106224980 CTACAGAGACAGAAAGTAGATGG - Intergenic
959693900 3:109229342-109229364 CTTGAAAGAGAGAAGTTGGCTGG + Intergenic
960157353 3:114309352-114309374 CCTCTGAGAGAGATGGTGGAAGG - Exonic
960158066 3:114318191-114318213 CTTCACAGTGAGCAGATGGATGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961094759 3:124144715-124144737 CTGCAGAGAGACAAGAGGGAAGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961773767 3:129269185-129269207 GTTCAGAGAGAGAAAGTAGTAGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962047532 3:131776444-131776466 ATTCAGAGAGAGGAGGCTGATGG + Intronic
962388579 3:134953125-134953147 CATCAGAGAGGGAAGCTGGCAGG - Intronic
962638053 3:137351147-137351169 CATCAGATAGAAAAGTTGGACGG - Intergenic
963111561 3:141692929-141692951 CTTGAGGGACAGAAGTTGGAAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963746076 3:149126366-149126388 CTTCAGATAGAGCAGTTGGTGGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964630048 3:158800793-158800815 ATTTAGAGAGAGAAGGAGGTAGG - Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
965855569 3:173083635-173083657 TTTCGGGGAGAGAAGGAGGAAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
968015916 3:195332640-195332662 GTCAAGAGAGACAAGGTGGAGGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968580086 4:1385704-1385726 CTTCAGAGACAGATGGGCGACGG - Intronic
968648207 4:1750172-1750194 CTGCAGAGAGAGGAGGGGGCGGG + Intergenic
970211584 4:13715678-13715700 CTTCTGGGAAAGAAAGTGGATGG + Intergenic
970323265 4:14896779-14896801 GTGCTGAGAGAGAAGGAGGAGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971685505 4:29760959-29760981 CCTCAGAGAAAGAAAGGGGAAGG - Intergenic
971924422 4:32988727-32988749 CTTTAGAGAGATAAGGGTGAAGG - Intergenic
972498683 4:39657571-39657593 CTTCAGAGAGAGAAGGGGAGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973652074 4:53006319-53006341 CTTCAGAGAGCTATGGTAGAGGG - Intronic
973825982 4:54708162-54708184 ATTCAGGGAGAGCAGGAGGACGG + Intronic
974949775 4:68573869-68573891 GTTGAGAGACAGAAGCTGGATGG + Intronic
975407240 4:74003654-74003676 GTTCAAAGAGCAAAGGTGGACGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975867496 4:78739087-78739109 TTTCAGATAGAGAAGTTAGAAGG + Intergenic
975980470 4:80152808-80152830 CTTCAGACAGAGAACATGGCTGG - Intergenic
976004455 4:80412565-80412587 CCTCAGAGAGAGAAAGCTGAAGG + Intronic
976222587 4:82769788-82769810 CTACAGAGTGAGAGGGAGGAAGG + Intronic
977492484 4:97732226-97732248 CTTCCCAGAGAGGAGATGGAGGG - Intronic
978045864 4:104126389-104126411 TTTTAGAGAGAGAAGCTGGAGGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978463727 4:108985192-108985214 CTCCACAGAGAGAAGGATGAAGG - Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
978732199 4:112041327-112041349 CTTCAGAGAGAGAAGTTAATAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
980174136 4:129324658-129324680 CTTTAGAGAGAGATGGGGGGTGG + Intergenic
981272781 4:142864073-142864095 CATAAGAGACAGAAGGTAGAAGG - Intergenic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
981715109 4:147744916-147744938 CTGCCGAGAGAGAATGTAGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984982721 4:185298625-185298647 ATGCAGAGAGACAGGGTGGAAGG - Intronic
985724088 5:1506566-1506588 CTGCAGAGAGAGAAGCTGGCTGG + Intronic
986015645 5:3754750-3754772 CTCCCCAGAGAGGAGGTGGAGGG + Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
987554612 5:19431042-19431064 CTTCAGGGACTGAAGGGGGATGG - Intergenic
989251746 5:39324873-39324895 ATTCAGAGAGAGAAGATCAAGGG + Intronic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990543481 5:56798349-56798371 GTTCAGAGAGAGAATGTGAACGG + Intergenic
990775008 5:59296498-59296520 CATAAGCCAGAGAAGGTGGAAGG + Intronic
990880666 5:60533944-60533966 CTTCATAGTGAAAGGGTGGAAGG - Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991139069 5:63217764-63217786 CTTCAGAGTAGGAAGGAGGAGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991669719 5:69035901-69035923 GTTCAGAGAGATGAGGTGGCTGG - Intergenic
992036063 5:72777940-72777962 AGTAAGAGAGGGAAGGTGGAGGG + Intergenic
992074018 5:73174460-73174482 CTTCCTACAGAGAAGGGGGAGGG - Exonic
992081632 5:73239114-73239136 CTTCGGAGAGGGAATGTGGGTGG + Intergenic
992182678 5:74213398-74213420 CGTCAGAGACAGAAGGTTGCAGG + Intergenic
992701788 5:79348281-79348303 CTTCAGAGTGAGAATATGTATGG - Intergenic
993100529 5:83533407-83533429 TTTCAGAGAGAGAGAGAGGAAGG + Intronic
997431104 5:133841820-133841842 CTGCTGAGAGAGGAGGTGGAAGG + Intergenic
999066142 5:148687486-148687508 CAGCTGAGAGAGAAGGTGAATGG - Intergenic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001066229 5:168536975-168536997 ATTCAGTGAAAGAAGGTGCATGG - Intergenic
1001908634 5:175495255-175495277 ATTCAGAGACAGAAAGTAGAGGG + Intronic
1002286621 5:178166554-178166576 CTGCAGTGAGGGAAGGTGGGTGG + Intergenic
1003152836 6:3567054-3567076 CTACAGAGAGAGATGGTGGCTGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003752980 6:9082878-9082900 CTTCATAGAGAAAAGATGTATGG + Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004891848 6:20108489-20108511 CTATAGAAAGAGAAGGTTGAGGG - Intronic
1005700285 6:28393866-28393888 CTTCCCAGAGAGAAGTGGGACGG - Intronic
1005902963 6:30235125-30235147 CTTTATGGAGACAAGGTGGAGGG - Intergenic
1006143599 6:31945401-31945423 ATTCAGAGGTAGAAGATGGAGGG - Exonic
1006155510 6:32011011-32011033 CCTCAGAGTGTGCAGGTGGACGG - Intergenic
1006161843 6:32043865-32043887 CCTCAGAGTGTGCAGGTGGATGG - Exonic
1006479634 6:34281347-34281369 TATCAGAGAGAGGAAGTGGAAGG - Exonic
1006796474 6:36735524-36735546 CTTCAGAGACGGCAGGAGGAGGG - Intergenic
1006934204 6:37705865-37705887 GTTCAGAGAGAGACGGGGGCGGG + Intergenic
1007184775 6:39960153-39960175 CTTCAGGGAGAGCAGGTGTCTGG - Intergenic
1007270807 6:40635534-40635556 TTTCAGAGAGTGGAGGGGGAGGG - Intergenic
1007706754 6:43795769-43795791 CTTCAGAGAGGGAGAGAGGATGG - Intergenic
1007941994 6:45789992-45790014 CTTGAGGCTGAGAAGGTGGAAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008717456 6:54306340-54306362 GTTCAGAGAGAGAAAGTTGGAGG + Intergenic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1009679875 6:66878588-66878610 CTTCTGAGAGAGAAGGGCTAAGG - Intergenic
1009780006 6:68257420-68257442 TTTGAGAGAGAGAGGGTGGGTGG - Intergenic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010592605 6:77728037-77728059 GTTGAGAGAGTGAAGGTGAAAGG + Intronic
1010854251 6:80817598-80817620 GTTCAGAGAGAGCAGGGGAACGG - Intergenic
1011263623 6:85492981-85493003 CTTCCGTGACAGAAGATGGAAGG + Intronic
1011266802 6:85529527-85529549 TTTCAGAGAAAGAACGAGGATGG + Intronic
1011813385 6:91159178-91159200 CGTAAGGGAGAGAAGGTGGTGGG + Intergenic
1012221658 6:96657126-96657148 CTTCAGAGAGAAAATGCTGAGGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013041718 6:106440789-106440811 CATCAGAAAGAGATGGTGGGTGG - Intergenic
1013075243 6:106765286-106765308 TTTCAGAGACAGAAGGGTGAGGG + Intergenic
1014114363 6:117655640-117655662 CTTCAGAGAGAGGATGTTCATGG + Intergenic
1014493809 6:122094314-122094336 CCTCAGAAAGGGGAGGTGGAGGG + Intergenic
1014518565 6:122409399-122409421 TTTCAGTGAGAGTAAGTGGATGG + Intronic
1014654283 6:124079968-124079990 CCTCAGAGAGAAATGGTGGGTGG + Intronic
1014689709 6:124548575-124548597 CTTCAGAGAGGGAAGAGGAAAGG + Intronic
1016735629 6:147476723-147476745 CCTCAGAGACAGTAGGAGGAAGG - Intergenic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1018609960 6:165638385-165638407 AGACAGAGAGAGAGGGTGGAAGG + Intronic
1019268134 7:130433-130455 CTTCAGGGAGTGAATGTCGACGG + Intergenic
1019398439 7:836233-836255 CTGCAGAGAGAGAGGAGGGAAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019495903 7:1340536-1340558 CTTTAGACAGAGAAGCTGGGTGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1021491338 7:21222389-21222411 CTTCAGAGAATGAAAGTGGAAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021894009 7:25216231-25216253 TGACAGAGAGAGAAGGTTGAAGG + Intergenic
1021928897 7:25560441-25560463 GTCCAAAGAGACAAGGTGGATGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023074881 7:36472771-36472793 CTTGAGAGACAGCAGGTAGATGG + Intergenic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026120022 7:67528985-67529007 CTTCCTAGATACAAGGTGGAGGG + Intergenic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1028325241 7:89516084-89516106 GTTCAGAAAGAGAAGGAGGTGGG + Intergenic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029778260 7:102701965-102701987 CTTCAGAGAGAGAAAGAGAGAGG + Intergenic
1029866035 7:103630080-103630102 CTTCCCAGAGAGAAGATGTATGG - Exonic
1029957773 7:104657725-104657747 CTCCAGAGATGGAAGATGGAGGG - Intronic
1030638251 7:111974556-111974578 TTGCAGAGAGAGGAGGAGGAAGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031495199 7:122438465-122438487 CTACAGAGAGAGGAAGTGGAAGG + Intronic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1031981663 7:128130916-128130938 ATTCAGGGAGAAAAGGAGGAAGG - Intergenic
1033026700 7:137781477-137781499 GTTGAGAGAGAGGAGGAGGAAGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1033519362 7:142145411-142145433 GATCAGAGAGAGAGGGAGGAAGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035724385 8:1815460-1815482 GATCAGAGAGAGAAAGTGGCAGG + Intergenic
1035742927 8:1942885-1942907 ATCCAGAGACAGAACGTGGATGG + Intronic
1035756617 8:2037495-2037517 CCTCAGGGAGAGAAGGTAGTTGG + Intergenic
1036165131 8:6425562-6425584 CTTCAGAGTGATAAGATGTAAGG - Intronic
1036712618 8:11091185-11091207 CTTGGGAGAGACAAGGTGGGAGG + Intronic
1037882009 8:22578157-22578179 CTTCACAGAGTGAGCGTGGAGGG + Intergenic
1038421357 8:27436046-27436068 CTTCAGAGGGAGCAGGGTGATGG + Intronic
1038557299 8:28532655-28532677 CTTTAGAAAGCCAAGGTGGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039260310 8:35764329-35764351 CTTCAGAGAGAGATGGCAGTTGG + Intronic
1039813228 8:41068587-41068609 CTTCAGTGGGAGAAGAAGGAAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041118165 8:54560653-54560675 CTTAGGTGAGAGAAGGTGCACGG - Intergenic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1041713107 8:60910758-60910780 TTTCAGAGAGATGGGGTGGAGGG + Intergenic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1043101672 8:76055037-76055059 CTGCAAAGAGATAATGTGGAAGG - Intergenic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1043827814 8:84949984-84950006 CTTCTTAGAGAGAAGTGGGATGG - Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045392262 8:101727182-101727204 CTTTAGAGAGAGCAGTTGGGTGG - Intronic
1046315173 8:112491409-112491431 CTTTAGAAAGTGGAGGTGGATGG + Intronic
1046330233 8:112704646-112704668 CTTGAGAGAGAGAGAGAGGATGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046676466 8:117114329-117114351 GTTCAGAGGGGCAAGGTGGAAGG - Intronic
1046860057 8:119080734-119080756 GTTCAGAGAGGGAAGGGTGATGG - Intronic
1047127601 8:121979975-121979997 ATTCAGGTAGAGAAGGCGGAGGG - Intergenic
1047148186 8:122229878-122229900 CTGGAGTGAGAGCAGGTGGATGG + Intergenic
1047194642 8:122710549-122710571 CTCCAGAGAGGGAAACTGGATGG - Intergenic
1048176050 8:132153804-132153826 ACTCAGAGATAGAAGGAGGAAGG + Intronic
1049368435 8:142252038-142252060 CTGCAGATAGAGAACGTGGGCGG - Intronic
1049739882 8:144233533-144233555 TCGTAGAGAGAGAAGGTGGATGG - Intronic
1049760533 8:144330193-144330215 CTTCAGGGAGAGAAGAGCGAAGG + Intergenic
1049851923 8:144837246-144837268 CTGCAGGGAGAGTGGGTGGAGGG - Intronic
1050271324 9:3948560-3948582 TTCCAGAGAGAGGGGGTGGAAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051035461 9:12739398-12739420 ATGCAGAGAGAGAGGGTGGGAGG + Intergenic
1053642985 9:40106102-40106124 CTTAAGAGAGAGACGGTAGTGGG + Intergenic
1053763166 9:41359380-41359402 CTTAAGAGAGAGACGGTAGTGGG - Intergenic
1054541775 9:66270519-66270541 CTTAAGAGAGAGACGGTAGTGGG - Intergenic
1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG + Intronic
1055710850 9:79060498-79060520 AGTCAGAGAGAAAAGGTGCATGG - Intergenic
1055750664 9:79501173-79501195 TTTCAGAGAGAAAAGGGGGAGGG + Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057288144 9:93777265-93777287 TTGCAGAGAGAGATGGTAGAAGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058593614 9:106591395-106591417 CTTCAGAGAGAGAAAGAGAAAGG + Intergenic
1058634071 9:107019440-107019462 CTTGAGAGAGAGAGGGTTGAGGG + Intergenic
1058737065 9:107903567-107903589 CTTCAGAGATAGCCCGTGGACGG + Intergenic
1058772798 9:108254018-108254040 CTTCAAAGAGAGATGATGGGAGG - Intergenic
1058983135 9:110188487-110188509 CTCCTGAGAAAGAAGTTGGAGGG + Intergenic
1059202507 9:112431145-112431167 CTGCAGATAGAGCAGATGGAGGG + Intronic
1059986727 9:119827650-119827672 CATCAGAGAGAGAAGGGGCAGGG + Intergenic
1060155043 9:121313731-121313753 AGTCAGGGAGACAAGGTGGAAGG + Intronic
1060405501 9:123371047-123371069 CTGCAGGGAGAGAAGGTGCCAGG - Intronic
1060956848 9:127647675-127647697 CTACAGAGAGACAAGAAGGAGGG - Intronic
1061293971 9:129667053-129667075 TTTCAGAGACAGGAGGTGCAGGG + Intronic
1061599567 9:131658650-131658672 CTACCGAGAGAGAAAGAGGATGG + Intronic
1061723221 9:132566637-132566659 CTTTAGAAAGAGAAGGGAGATGG - Intronic
1061995612 9:134181313-134181335 CATCAGAGAGAGCAGGGAGAGGG + Intergenic
1062210431 9:135360606-135360628 CTCCTGGGAGAGAAGGTGGACGG + Intergenic
1062302443 9:135882403-135882425 CTTCAGAGAAAGATGGGGGTGGG + Intronic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1185952473 X:4451950-4451972 CTTCAGTGAGGGAGGCTGGATGG + Intergenic
1186540472 X:10395083-10395105 CTTCAGAGAGAGAAGATCCTTGG + Intergenic
1186656008 X:11612851-11612873 CTTAAGAGTGAGAATGTAGAAGG - Intronic
1186852234 X:13591921-13591943 CTTCAGATAGAGAAGTTTGGGGG + Intronic
1187298517 X:18026175-18026197 TTTCAGAAAGAGAAGGGGTAGGG - Intergenic
1187350818 X:18515261-18515283 CTTGATAGAGAGAGGCTGGAGGG + Intronic
1187767699 X:22661557-22661579 CTTCAGAGAGTGAGGGCAGAAGG - Intergenic
1187945823 X:24425607-24425629 ATTGAGAGAGAGATGGTGGCAGG + Intergenic
1188137224 X:26504941-26504963 CTTCAGGTAGAGGGGGTGGAAGG - Intergenic
1188137266 X:26505082-26505104 CTTCAGGTAGAGGGGGTGGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190446587 X:50531565-50531587 CTACAGAGGGACAAGGTGGCTGG - Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1194983176 X:100461110-100461132 CTTCTGAGAGAGAGGGTGCTCGG - Intergenic
1195575003 X:106439605-106439627 ATTCACAGAAAGAGGGTGGAGGG - Intergenic
1195637224 X:107131956-107131978 CTTCTGACAGAGAAGAAGGAAGG + Intronic
1195722054 X:107876963-107876985 AGTGAGAGAGAGAAGCTGGATGG + Intronic
1196699114 X:118646892-118646914 TTTCAGAGAGTGAAGCTAGAGGG - Intronic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197686367 X:129443413-129443435 CTTCAGAAAGAGATAGTGGCAGG + Intergenic
1198006243 X:132497433-132497455 CATTAGTGAGAGAATGTGGAAGG + Intergenic
1198559119 X:137829575-137829597 GTTTGGAGAGAGAAGGTGGCTGG + Intergenic
1199713352 X:150488127-150488149 CTTCCCAGAGAGAAGGGGGAGGG - Intronic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1201235666 Y:11908470-11908492 CTGCAGAGAAGGAAGGTGGCAGG + Intergenic
1201693837 Y:16800944-16800966 ATTCAGAGAGAGAAAGAAGAGGG - Intergenic