ID: 915004074

View in Genome Browser
Species Human (GRCh38)
Location 1:152620868-152620890
Sequence AGATCTAGACTGCTAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915004074 Original CRISPR AGATCTAGACTGCTAATTGG TGG Intergenic
905689292 1:39930992-39931014 ATTTCCAGACTTCTAATTGGTGG + Intergenic
913084166 1:115419932-115419954 ACATGTAAACTGCTAATTGTAGG + Intergenic
915004074 1:152620868-152620890 AGATCTAGACTGCTAATTGGTGG + Intergenic
916347665 1:163812341-163812363 AGCTCTGGACTGCTAATTCCTGG - Intergenic
919253015 1:195083418-195083440 GGATCTAGATTGATAGTTGGAGG - Intergenic
919588967 1:199475447-199475469 AGAGCTAGAATGCTAATTAATGG - Intergenic
922661755 1:227436206-227436228 GGACCTAGACTGCCTATTGGGGG - Intergenic
924161717 1:241239651-241239673 GGATCTAGACTGAGAATGGGAGG - Intronic
1064715925 10:18176661-18176683 AGATCTAGAATGCCAAATGGAGG + Intronic
1070531353 10:77340000-77340022 ACATCTAGACTTCTACTTGTAGG + Intronic
1071175310 10:82919277-82919299 ACATCTAGACTGGCAATTGACGG + Intronic
1071986709 10:91058870-91058892 TCATTTAGACTGTTAATTGGTGG + Intergenic
1082718684 11:56646621-56646643 AGATCTAGTCTGCTATTTTGTGG - Intergenic
1088138918 11:106592119-106592141 AGATCTCGCCTGTTGATTGGTGG - Intergenic
1091074070 11:132598174-132598196 AGAGCTAGACTGCGAATTCCAGG - Intronic
1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG + Intronic
1093771475 12:23022980-23023002 AGAGCAAGACTCCTTATTGGGGG - Intergenic
1096035091 12:48459887-48459909 AGGTCTAGACTTTTAACTGGAGG + Intergenic
1098909822 12:76197515-76197537 AGCTCTACACTGCTGAGTGGAGG + Intergenic
1099909230 12:88809467-88809489 TGGTTTAGACTGCTAATTGATGG - Intergenic
1101055415 12:100907394-100907416 AGATCTAGAAAGCTTCTTGGAGG - Intronic
1106095742 13:26641378-26641400 ACACCTAGGCTGCTAACTGGGGG - Intronic
1113321803 13:109240425-109240447 AGAGCTAGGTTGCTAAATGGTGG + Intergenic
1116363215 14:44027916-44027938 AGAACTAGACTGGTGATGGGTGG - Intergenic
1117757247 14:58988389-58988411 AGATCTAGACTTTTATTTTGAGG + Intergenic
1135226313 16:20661929-20661951 AGAACTAGACTGCTAATAATTGG - Intronic
1135349741 16:21718653-21718675 TGTTCTAGAGTGCTCATTGGGGG + Intronic
1142858634 17:2748117-2748139 AGATGTGGACTGCTAAATGCAGG - Intergenic
1145374801 17:22337594-22337616 AGATCTAGACTGTCATTTTGAGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1165449992 19:35876661-35876683 AGATCTTGACTCCTAAATGTTGG + Intronic
925869697 2:8258845-8258867 ATATCTAAACTGCTTTTTGGAGG - Intergenic
929291202 2:40193878-40193900 AGATCTAGACTGGAGATAGGGGG - Intronic
932744550 2:74322151-74322173 AGCTCTGGACTGCTTATTGCTGG + Intronic
933263409 2:80154746-80154768 AGATCTGGGCTGATAAGTGGAGG - Intronic
936111206 2:109666675-109666697 ACATGTTGGCTGCTAATTGGAGG + Intergenic
936968369 2:118149729-118149751 AAATCTGGACTGCTTCTTGGAGG + Intergenic
940140427 2:150486285-150486307 AGATCTAACCTGCTGGTTGGCGG - Intronic
940250314 2:151668585-151668607 TGGTCTAGACATCTAATTGGTGG - Intronic
946492870 2:220166995-220167017 ATATCTAGACTGCCTACTGGTGG - Intergenic
1177291817 21:19122409-19122431 AGTTCTAGACAGATAAATGGAGG + Intergenic
951024740 3:17817353-17817375 AGATACAGAGTGCTGATTGGTGG + Intronic
951110604 3:18799240-18799262 ACATCTAGACTGCCAATTTGTGG + Intergenic
957174799 3:76793347-76793369 AGATCCACATTGCTAATAGGGGG + Intronic
960641943 3:119833340-119833362 AGATCTAGAATACTAATTCATGG - Intronic
962008265 3:131369679-131369701 AGATCCTGAATCCTAATTGGGGG - Intergenic
970122809 4:12775939-12775961 AGATATAGACTAGTAATGGGTGG - Intergenic
976702311 4:87984638-87984660 AGAGATAGACTGTAAATTGGTGG + Intergenic
978625282 4:110678371-110678393 ATATCTAGATAGCTATTTGGGGG - Intergenic
979345869 4:119586188-119586210 AGATCTAGACTTCTAAATCCAGG + Intronic
979782861 4:124677263-124677285 AAATCTAGACTTGTAATTGCTGG - Intronic
986438110 5:7755195-7755217 AGAGCTGGACTGCTGACTGGCGG - Intronic
989325905 5:40194198-40194220 ATATATAGATTGCTAATTGTTGG - Intergenic
992887785 5:81176251-81176273 TGGACTACACTGCTAATTGGTGG + Intronic
996236283 5:121134667-121134689 AAATCTACACAGCTAATTGATGG + Intergenic
996831587 5:127746471-127746493 TGATCTAGACTGCTATTTCCAGG - Intergenic
997096745 5:130922002-130922024 AGATGTAGGTTGCTGATTGGTGG - Intergenic
998985272 5:147750122-147750144 AGATCTAGACGTGTAATTGCTGG - Intronic
1002715537 5:181224392-181224414 AGACCTGGACTACTACTTGGGGG + Exonic
1004047411 6:12039832-12039854 AGATCCAGGCTGCTCATGGGTGG - Intronic
1006579103 6:35066388-35066410 AGATCTACACGGCTGATTTGGGG + Intronic
1007189895 6:40004465-40004487 TAATCTAGACTGCTAATGGGAGG - Intergenic
1008065708 6:47045702-47045724 AGACCTGGACAGCTAATTAGAGG + Intergenic
1014442963 6:121494507-121494529 TGCTCTAGAATGCTAATAGGAGG - Intergenic
1016558370 6:145366721-145366743 AGATCTTGCCTGCCAATTTGTGG - Intergenic
1017943309 6:159072811-159072833 ATATCTAGAATGCTAAATGTTGG - Intergenic
1020478061 7:8622393-8622415 AGAACTAGACTTATAATTGAAGG - Intronic
1021346522 7:19536137-19536159 AGACATAGACTACTAATTTGAGG - Intergenic
1030206715 7:106958565-106958587 AGGTATAGACTGCTAATGGATGG + Intergenic
1030801117 7:113853757-113853779 AGAACTAAAAAGCTAATTGGAGG + Intergenic
1038978958 8:32735597-32735619 ACATATCGACTGCTAATTTGTGG - Intronic
1046123186 8:109870346-109870368 AGCTCTAGAATGCTAATGGAGGG + Intergenic
1053100506 9:35367890-35367912 AGGTCTAGATAACTAATTGGTGG - Intronic
1053366019 9:37523097-37523119 AGATTTACAGTGCTAATTGCTGG - Intronic
1055365680 9:75542294-75542316 ACATCTAGACTGATACTTGAAGG + Intergenic
1055419684 9:76125714-76125736 ACATCTTGACTGCTAACTTGTGG - Intronic
1057727002 9:97574691-97574713 AGATACAGAGTGCTGATTGGTGG - Intronic
1058621087 9:106883897-106883919 AGGTCTAGTCTGCTAATTGCTGG + Intronic
1195945350 X:110204546-110204568 AGAACTAGAATGCTTATTAGAGG - Intronic
1196029802 X:111084572-111084594 ACTTCTAGACTGCTACTTTGGGG + Intronic
1197885764 X:131216705-131216727 GGATCTCGAGTGTTAATTGGGGG - Intergenic
1198880679 X:141277746-141277768 AGATCTAGACTGCTAACCTTAGG - Intergenic