ID: 915004368

View in Genome Browser
Species Human (GRCh38)
Location 1:152622994-152623016
Sequence TCCAGCTGTGCCCCAAGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915004368_915004375 17 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004375 1:152623034-152623056 ACTGTGCTGGGCTCTTTGCAGGG 0: 1
1: 0
2: 4
3: 36
4: 427
915004368_915004378 28 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004378 1:152623045-152623067 CTCTTTGCAGGGCACTTGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 251
915004368_915004374 16 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004374 1:152623033-152623055 CACTGTGCTGGGCTCTTTGCAGG 0: 1
1: 2
2: 6
3: 67
4: 505
915004368_915004373 5 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004373 1:152623022-152623044 CTGGAGGCAGACACTGTGCTGGG 0: 1
1: 3
2: 11
3: 69
4: 689
915004368_915004376 24 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004376 1:152623041-152623063 TGGGCTCTTTGCAGGGCACTTGG 0: 1
1: 0
2: 0
3: 42
4: 297
915004368_915004372 4 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004372 1:152623021-152623043 GCTGGAGGCAGACACTGTGCTGG 0: 1
1: 3
2: 4
3: 41
4: 403
915004368_915004377 25 Left 915004368 1:152622994-152623016 CCAGAGCTTGGGGCACAGCTGGA 0: 1
1: 0
2: 6
3: 38
4: 280
Right 915004377 1:152623042-152623064 GGGCTCTTTGCAGGGCACTTGGG 0: 1
1: 0
2: 4
3: 27
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915004368 Original CRISPR TCCAGCTGTGCCCCAAGCTC TGG (reversed) Exonic
900483415 1:2910263-2910285 ACCAGCTCTGCCCCAAGGGCTGG + Intergenic
901032711 1:6317414-6317436 TCCAGCTGTTTCCCAAACTCTGG + Intronic
901451366 1:9338609-9338631 TCCAGCTGTGACCAACTCTCTGG - Intronic
901530551 1:9849901-9849923 TCCAGCTGTGGACCCTGCTCAGG + Exonic
901814950 1:11788635-11788657 GCCAACTGTCCCCAAAGCTCAGG + Exonic
902628559 1:17690811-17690833 TGCAGCTGCCCCCCACGCTCTGG - Intronic
902948874 1:19865146-19865168 TCAAGCTCTGCTCCAAGCTCTGG + Intergenic
904592274 1:31621561-31621583 TCCAGATATTCCGCAAGCTCTGG + Exonic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
905979853 1:42214682-42214704 TGCAGCTTTGCCCCAAGATTAGG + Intronic
907318495 1:53587983-53588005 TCCAGTTCTGGCCCAAGTTCAGG - Intronic
911663317 1:100527637-100527659 TCCAGCTGTACCCGAGGCCCAGG - Intergenic
912435708 1:109659662-109659684 TCCAGCTCTGGCCACAGCTCTGG - Intronic
912494421 1:110082394-110082416 TCCAGTCTGGCCCCAAGCTCAGG + Intergenic
912799112 1:112710285-112710307 TACAGCTCTGGCCCAAGCTCTGG - Exonic
914998580 1:152566084-152566106 TCTGGCTGTGCCCCAAGCTCTGG - Exonic
914999933 1:152579812-152579834 TCTGGCTGTGCCCCAAGCTCTGG - Exonic
915002304 1:152604414-152604436 AGCAGCAGTGCCCAAAGCTCTGG - Intergenic
915003375 1:152613913-152613935 TCCTGCTGTGCTCCAAGACCTGG + Exonic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
915007852 1:152656447-152656469 TCCTGCTGTGGGCCTAGCTCTGG + Intergenic
915008651 1:152664241-152664263 TCCTGCTGTGGTCCCAGCTCTGG + Exonic
915012309 1:152699025-152699047 TCCTGCTGTGGTCCCAGCTCTGG + Exonic
915013221 1:152709190-152709212 TCCTGCTGTGGCTCCAGCTCTGG + Exonic
915531473 1:156504870-156504892 CAGAGTTGTGCCCCAAGCTCAGG + Intergenic
915534840 1:156529082-156529104 TCCATCTGTTCCCCAACCCCAGG - Exonic
919802626 1:201362650-201362672 TCCAGCTTAGTCCCTAGCTCAGG - Intronic
920367339 1:205455162-205455184 TCCAGGTGGGCTCCTAGCTCCGG + Intronic
920541084 1:206778420-206778442 TCCATTTGTGCCCCACACTCAGG - Intergenic
921134446 1:212247604-212247626 TTCAGATGTGACTCAAGCTCAGG - Intergenic
921818178 1:219587303-219587325 TCCAGCTGTGCCCCACCCTTGGG - Intergenic
922697302 1:227737075-227737097 TCCCTCTGTGCCCCAACCACAGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924021885 1:239792076-239792098 TGCTGCTGTGGTCCAAGCTCTGG + Intronic
924054753 1:240114388-240114410 TCCTGCTGTCCCCCAGCCTCTGG - Intronic
1064635743 10:17364725-17364747 TCCAGCTGTGGGCCAAGTTGGGG + Intronic
1065390434 10:25176149-25176171 GCCAGCTGTGGCCCAGGCCCCGG - Exonic
1065626516 10:27635046-27635068 TTCTGCTGTGCGCCAAGTTCAGG - Intergenic
1066306637 10:34150656-34150678 TCCAGCTGGGCCTCAGGCTTGGG + Intronic
1066435897 10:35396614-35396636 TCCAGCCTTGCCCCAAGGGCTGG + Intronic
1066440790 10:35436491-35436513 TGGAGCAGGGCCCCAAGCTCAGG - Intronic
1067178774 10:43969665-43969687 TCCTGCTGTGGCCCCCGCTCTGG + Intergenic
1069534362 10:69241962-69241984 TCCAGCTGACCCCCTCGCTCTGG - Intronic
1070644578 10:78192763-78192785 TCCAGCTCTGCCCCAATCTTAGG - Intergenic
1072460293 10:95612279-95612301 TTCAGCTCAGCCCCAGGCTCTGG + Intronic
1072502334 10:96030331-96030353 TCCTACTCTACCCCAAGCTCTGG + Intronic
1073186604 10:101618832-101618854 CCCAGCTGTGCCCTGTGCTCAGG + Intronic
1075495018 10:122912450-122912472 TTCAGCTGTGCCCCAGGCTCCGG - Intronic
1077113042 11:870277-870299 TCCAGCTGTGCTCCAGGGCCGGG + Intronic
1078092801 11:8277798-8277820 GCCAGCTGTGCCACGTGCTCTGG + Intergenic
1079081011 11:17413779-17413801 CCCTGCAGTGCCCCAAGCACGGG - Intronic
1079527060 11:21403435-21403457 TCTAGCTGTGTCCTAAGATCAGG - Intronic
1081929319 11:46857790-46857812 TCCAGCTGTCCCCTCAGCTAAGG - Exonic
1084315582 11:68343520-68343542 GCCAACTGTGCCCCATGCCCTGG - Intronic
1084691999 11:70732897-70732919 TCCGGCTGTAACCCCAGCTCTGG + Intronic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1085414745 11:76312531-76312553 TCCAGCTGTGCCCACCTCTCCGG - Intergenic
1085642519 11:78201350-78201372 TCCTGCTCTGCACCAAGCCCAGG + Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086399420 11:86448342-86448364 TCCTGCTGAGCCCCATGCTTTGG + Intronic
1087018573 11:93579042-93579064 TTCAGCTGAGCCCCTTGCTCAGG - Intergenic
1088815663 11:113419126-113419148 TCCTGCTCTGGCCCAGGCTCTGG + Intronic
1090206554 11:124887479-124887501 AGGAGCTGTGCCCCAAGCTCTGG - Exonic
1091184744 11:133637308-133637330 ACCTGCTGTGCCCCCCGCTCAGG + Intergenic
1091936922 12:4441940-4441962 GACAGCTGTGCCCCAAGCCTGGG - Intronic
1093147868 12:15588490-15588512 TCCATCTGTGCCCCGAGCATTGG + Intronic
1093785953 12:23192577-23192599 TCCAGCAGTGTGTCAAGCTCAGG + Intergenic
1094035207 12:26062938-26062960 TCCAGCTATACCCCAAATTCAGG + Intronic
1094437706 12:30439772-30439794 CTCAGCTGTGCCCCATGCTCTGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096390656 12:51226446-51226468 TCCAGCTGTGCCGGAGGCTGAGG - Intergenic
1096524247 12:52201152-52201174 TGCAGCTGTGTCCTCAGCTCAGG + Intergenic
1096848491 12:54420576-54420598 CCCACCTCTTCCCCAAGCTCAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099395153 12:82129247-82129269 TCCAGCTGTTCCATAAGCTGAGG + Intergenic
1101203680 12:102463780-102463802 TCCAGCTGTGCAAAGAGCTCTGG + Intronic
1101856379 12:108446793-108446815 TCCAGCTGTTCCCAAAACCCAGG - Intergenic
1103736377 12:123063424-123063446 ACCAGCTGTGTGCCAAGCCCTGG - Intronic
1103792486 12:123481498-123481520 TCCAGCTGAGCCCCACGCTGTGG + Intronic
1104931920 12:132344289-132344311 TCCAGCTGTGCCCGAGGCCCTGG - Intergenic
1104995074 12:132649224-132649246 TCCAGCTGGGCCCTGAGGTCTGG - Intronic
1105847383 13:24305214-24305236 TCCAGCTGAGCCCTAACTTCCGG + Exonic
1109988064 13:70016547-70016569 GCCAGCACTGCCCCAAGCACAGG - Intronic
1112024585 13:95400429-95400451 TCCACCTGTGCCCTGACCTCTGG + Intergenic
1112416335 13:99206273-99206295 TCCAACTGTCCCCCCACCTCTGG - Intronic
1112484571 13:99808968-99808990 TCCAGCTGTGCTAGATGCTCAGG - Intronic
1114183619 14:20384216-20384238 TCCAGCAGGGCCCCAGGCTGAGG + Exonic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116995870 14:51323479-51323501 TCCAGATGTGTCCCAAGCTCAGG - Intergenic
1117582036 14:57161125-57161147 TCCCTCTCTGCCCCATGCTCTGG + Intergenic
1119427337 14:74544238-74544260 CACAGCTGTTCCCCAAGCTGGGG + Intronic
1121221397 14:92288266-92288288 TCCAGCTTTGCTCCAAGCCTGGG + Intergenic
1122031583 14:98916173-98916195 CCCAGCAGTGCCCCAATCTCAGG + Intergenic
1122136966 14:99638922-99638944 TCCAGCTGTGGCAGGAGCTCAGG + Intergenic
1122378261 14:101283462-101283484 TCCTCCTGTGCCCCAAGGACTGG + Intergenic
1122750422 14:103928677-103928699 TCCGGCTCTGGCCCAAGCTCCGG + Exonic
1124635816 15:31364689-31364711 TCCAGCTGCGGCTCTAGCTCTGG + Intronic
1125577030 15:40763322-40763344 TCCAGCTGCGCGGGAAGCTCAGG + Intergenic
1128381375 15:67115571-67115593 TCTCGCAGTGCCCCAAGCCCAGG + Intronic
1129756871 15:78104040-78104062 TCCAGCTGTACCCTCAGGTCAGG + Exonic
1129901962 15:79158106-79158128 TCCTGCTCTGCCCCAAGGCCAGG + Intergenic
1131605804 15:93901192-93901214 TGCAGCTGTGCCCCTAGCACGGG + Intergenic
1132583718 16:696755-696777 TCGAGGTGTGCACCAGGCTCGGG - Exonic
1132599851 16:768584-768606 CCCAGCTCTGCCCCCAGCCCTGG - Intronic
1132865034 16:2089093-2089115 GACAGCTGTGCCCCCAGCACCGG + Exonic
1134316216 16:13121126-13121148 TCCCCCTGTGGCCCAAGCTGGGG - Intronic
1135052082 16:19201346-19201368 TTTAGCTGTGCCTGAAGCTCAGG - Intronic
1135323357 16:21511476-21511498 TCCAGCTGTGGCCCACCCCCTGG + Intergenic
1135591284 16:23706720-23706742 CCCAGCTGTTCCTCAAGCTCTGG - Intronic
1136334842 16:29604742-29604764 TCCAGCTGTGGCCCAGCCCCTGG + Intergenic
1137271948 16:46907941-46907963 TCCACCAGTCCCCCAAGCCCAGG - Intronic
1137272053 16:46908317-46908339 TCCATCAGTCTCCCAAGCTCAGG - Intronic
1137272063 16:46908349-46908371 TCCACCAGTCCCCCAAGCCCAGG - Intronic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1137574536 16:49590288-49590310 TCCAGCTGTGCAGCATGCCCGGG - Intronic
1137674364 16:50296996-50297018 GCCAGCTGTGGCCCGAGCCCAGG - Intronic
1139510684 16:67426876-67426898 TCTTGCTGTGTCCCAAGCCCTGG - Intergenic
1141152595 16:81574460-81574482 TACAGCCGTGCCCCAGGTTCAGG + Intronic
1141168089 16:81673888-81673910 TCCTGCTGTATCCCCAGCTCTGG - Intronic
1142035561 16:87860560-87860582 TCCAGCTGTGGCCCACCCCCTGG + Intronic
1142291410 16:89195151-89195173 TCCAGTTGCGCCCCAGGGTCAGG - Exonic
1144655007 17:17029699-17029721 TCCAGCTGTGCCTGAAGCTACGG - Intergenic
1144965763 17:19076515-19076537 CCCAGCTCTGCCCCAGGCTCAGG - Intergenic
1144982204 17:19175667-19175689 CCCAGCTCTGCCCCAGGCTCAGG + Intergenic
1144986019 17:19202572-19202594 CCCAGCTCTGCCCCAGGCTCAGG - Intergenic
1146925333 17:36740475-36740497 GCCAGCTCTGCACCAATCTCAGG - Intergenic
1148119119 17:45197451-45197473 TCCAGCTCTACCCTGAGCTCTGG + Intergenic
1148340929 17:46872953-46872975 GCCAGCTGTGGCCCAGCCTCAGG + Intronic
1149600491 17:57890247-57890269 GCCATGTGTGCCCCAGGCTCAGG + Intronic
1151529383 17:74694954-74694976 GCCAGCATTGCCCCTAGCTCTGG - Exonic
1151892969 17:76962038-76962060 CCCAGCCCTGCCCCACGCTCTGG + Intergenic
1152386849 17:79979902-79979924 GCCTCCTGCGCCCCAAGCTCTGG - Intronic
1152537218 17:80957738-80957760 TGCAGGTGTCCCCCAAGCCCTGG + Intronic
1152660077 17:81537962-81537984 TCCCGCCGTGCCCCAGGCTGTGG - Intergenic
1153619229 18:6961549-6961571 TGCTCCTGAGCCCCAAGCTCAGG - Intronic
1156264416 18:35473395-35473417 TCCACCTCTGCCCCATGGTCAGG - Intronic
1157145956 18:45162773-45162795 TCCAGCTGTGCTACAGGATCAGG + Intergenic
1159461651 18:68728542-68728564 GCCAGCTGTGCCTAAAGCTGAGG - Intronic
1160276158 18:77438353-77438375 TCCAGCTTTGACCCAAGCCTAGG - Intergenic
1160564059 18:79776032-79776054 TCCTGCTGGGCTCCAGGCTCAGG + Intergenic
1160575092 18:79848701-79848723 TCCAGCTGTGCCCCAGCCCGTGG - Intergenic
1160848700 19:1179083-1179105 TCCAGCTCTGGCCCAGGCCCAGG + Intronic
1161060773 19:2213745-2213767 TCCAGCTGTGTCCCAGGGGCTGG + Intronic
1161633651 19:5373362-5373384 TGCAGCTGAACCCCCAGCTCCGG - Intergenic
1161736484 19:5995130-5995152 CCCAGAGGTGCCCCCAGCTCGGG + Intronic
1161965312 19:7544639-7544661 CCCAGCTCTGCCCCAGGCTTGGG + Intronic
1162363836 19:10236034-10236056 TCCAAGTGCGCCCCAAGATCTGG - Intergenic
1162373600 19:10292682-10292704 CGCAGCTGGGGCCCAAGCTCTGG + Exonic
1162583331 19:11544007-11544029 TCCTGCTGTGTGCCAGGCTCTGG + Intronic
1163460695 19:17435821-17435843 TCCAGCCGTGCCCCTGGCCCTGG + Exonic
1163575572 19:18109388-18109410 TCCAGCCTTGGCCCAAGCTGTGG + Intronic
1163692641 19:18745750-18745772 ACCAGCTGTGGCCCCAGCGCTGG - Intronic
1165520573 19:36311124-36311146 TCTAGCTCAGCCCCAAGCTCGGG + Intergenic
1165623498 19:37267460-37267482 TCTAGCTCAGCCCCAAGCTCGGG - Intergenic
1165635291 19:37334982-37335004 TCAAGCTCAGCCGCAAGCTCGGG - Intronic
1165690056 19:37856031-37856053 TGCAGCTGTGCCCCACGTTGGGG + Intergenic
1166205801 19:41268051-41268073 TTCAGCTGTATCCCAGGCTCTGG + Intronic
1166733484 19:45071358-45071380 TCCTGCTGCGCCCCAGGCACTGG + Intergenic
1167468519 19:49662888-49662910 TCCTGCTGAGGCCCAAGCTGGGG - Intronic
1167775505 19:51551987-51552009 TCCAGCCGTGGCTCCAGCTCTGG + Intergenic
1168348029 19:55660304-55660326 TCCAGCCCTGGCCCAAGCACTGG + Intronic
1168472566 19:56651330-56651352 TTCATCTCTGCCCCAAGCACAGG - Intronic
925917393 2:8616330-8616352 TCCGTCTGTGCCCCAATCCCAGG - Intergenic
925921650 2:8642459-8642481 ACCATCTGTGCTGCAAGCTCTGG + Intergenic
925995474 2:9289217-9289239 TCCAGCCCTTCCCCATGCTCTGG + Intronic
926913014 2:17869008-17869030 TCCGGCAGTGCCTCAACCTCTGG + Intergenic
927081115 2:19631479-19631501 TCCAGCTGTTCCTGAAGCTCAGG + Intergenic
928394748 2:30934842-30934864 CCCAACTCTGCCCCAAGCTCTGG + Intronic
928411887 2:31060716-31060738 ACCTGCTGGGCCCCAAGCACCGG - Intronic
928421554 2:31140829-31140851 TCCAGGGGTCCCCCATGCTCAGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931257507 2:60585949-60585971 TCCAGCAGTGACCAGAGCTCAGG + Intergenic
931802377 2:65771209-65771231 TCCAGCTGTGCTCCCAGCTTGGG + Intergenic
932418772 2:71589153-71589175 TCGAGCTGGGTCCCAAGCTCTGG - Intronic
932783497 2:74579012-74579034 TCCAGCTGTGCCTAAACATCTGG + Intronic
934502774 2:94872730-94872752 TCCTGCCATACCCCAAGCTCAGG + Intronic
934734910 2:96685272-96685294 TCCAGCTGGGCTCCATGCTGAGG + Intergenic
934747260 2:96767550-96767572 TCTAGCTGTGCCTCACCCTCTGG + Intronic
934905220 2:98194723-98194745 TCCAGCTCTGCCCTTGGCTCAGG + Intronic
937233469 2:120416190-120416212 TCCAGCTGTGCCCCTCTTTCTGG + Intergenic
938342895 2:130547251-130547273 GCCAGCTATGTCCAAAGCTCTGG + Intronic
938346938 2:130573471-130573493 GCCAGCTATGTCCAAAGCTCTGG - Intronic
938755199 2:134372949-134372971 TCCAGAAGTGCCCCACCCTCAGG - Intronic
938768455 2:134479758-134479780 CAGAGCTGTGTCCCAAGCTCAGG + Intronic
942147872 2:173043936-173043958 TCCAGCTGAGCCCCAATTTAGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945805677 2:214487349-214487371 ACCTACTGTGCGCCAAGCTCTGG + Intronic
947162234 2:227226300-227226322 TCCCTGTGTCCCCCAAGCTCTGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947808406 2:232983885-232983907 TCCAGCTGGGCCCCGAGTCCGGG + Intronic
948606615 2:239139766-239139788 TGCAGCAGCGCCCCAGGCTCCGG - Exonic
948776176 2:240290136-240290158 AACAGCTGTGCCCCACGCTGGGG + Intergenic
948856159 2:240731673-240731695 TCCTTTTGTGCCCCCAGCTCAGG + Intronic
1168975851 20:1965391-1965413 CCCAGCTCTGCCTGAAGCTCTGG - Intergenic
1169219806 20:3815440-3815462 CCCAGCTCTGCCACAAGCCCTGG + Intergenic
1171480937 20:25455155-25455177 TCCAGCTGTGTCCCCAGCAGAGG - Intronic
1173252881 20:41373988-41374010 GCCAGCTGTGCCACATACTCTGG - Intergenic
1174128314 20:48325003-48325025 GCCAGCTCTACCCCAGGCTCAGG - Intergenic
1174380741 20:50153857-50153879 TCCAGCTGCGTCCCAGCCTCCGG - Intergenic
1175335712 20:58194596-58194618 CCCAGCTGTGCCTCTAGCCCAGG + Intergenic
1175757358 20:61538275-61538297 TCCAGCTGTGCCCGTCACTCTGG + Intronic
1176269612 20:64229022-64229044 TCCAGCTGTGCCCAAACACCCGG + Intronic
1179502855 21:41820919-41820941 CCCTGCTGCGCCCCCAGCTCTGG + Intronic
1179607724 21:42528289-42528311 TCCAGCTGTGGCCTAGCCTCAGG + Intronic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1180999151 22:19979910-19979932 TCCAGCAGTGCCACAAGCAGCGG + Exonic
1181037142 22:20175146-20175168 CCCAGCTGTGCCCCCAGGCCTGG - Intergenic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1181523226 22:23461003-23461025 TCCAGCTCTGCCTCAAGGCCGGG + Intergenic
1182360046 22:29740948-29740970 TCCAGCTGCCCCCCATGCTGGGG + Intronic
1183991912 22:41602711-41602733 TCCTGATGTGCCCCAAGCCTTGG - Intronic
1184242904 22:43220829-43220851 TGAGGCTGTGCCCCCAGCTCTGG + Intronic
1184357540 22:43992564-43992586 CCAAGCTGGGCCCCAAGCCCGGG - Intronic
1184616537 22:45641649-45641671 TCCCTCTGTGTCCCAAGCCCAGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953407674 3:42667513-42667535 GCCTGCTGTGCCCCATGCTCTGG - Intergenic
953974209 3:47370380-47370402 TCCAGCTGTCACCCAACCTCAGG - Intergenic
954698696 3:52440792-52440814 TCCTGCTGTGGCCCAAGGCCGGG - Exonic
954823335 3:53349767-53349789 TCCCTCTGTTGCCCAAGCTCTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961809297 3:129512801-129512823 ACCTTCTGTGCCCCAAGCCCTGG + Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963900108 3:150725694-150725716 TCCGGCTGTGCTGGAAGCTCTGG - Intergenic
964128693 3:153263998-153264020 TCCAGCTGATACCCAAGATCTGG - Intergenic
966626781 3:182025390-182025412 TCCATCTCTGCCCCACTCTCAGG - Intergenic
966908033 3:184541964-184541986 CCCATCTGTACCCCAAGTTCAGG + Intronic
967606594 3:191454308-191454330 ACCAGCTTTGTGCCAAGCTCAGG + Intergenic
968956911 4:3724159-3724181 TGCAGCTGTGCCCCAAGAAGGGG + Intergenic
969620982 4:8278697-8278719 TGCAGGGGTGCCCCAGGCTCTGG + Intronic
973048650 4:45567466-45567488 TCCACCTGTGGCCCAAGTGCAGG + Intergenic
973626728 4:52779906-52779928 TCCCACTGTGCCCCAACCTGGGG - Intergenic
973912118 4:55592035-55592057 TCCAGCTGGGCCCGAAGCCAAGG - Intronic
974607604 4:64173617-64173639 TCCAGCTGTGCCCCAGAGCCTGG - Intergenic
977027838 4:91842787-91842809 TTCACCTGGGCACCAAGCTCTGG - Intergenic
977731348 4:100356457-100356479 TTCAGCATTGCCCCAAGCTGGGG - Intergenic
977763340 4:100766908-100766930 ACCACCTGTTCCCCAAGCTATGG + Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982708706 4:158737892-158737914 TCCAGATTTGCTCAAAGCTCAGG + Intergenic
983219678 4:165032191-165032213 ATCAGCTGTGCCCAAACCTCGGG + Intronic
984532343 4:180932357-180932379 TCCAGATGAGCTTCAAGCTCTGG - Intergenic
985749901 5:1667862-1667884 TTCCGCTGTGCCCCGGGCTCGGG + Intergenic
986423423 5:7607008-7607030 GACAGCTGAGGCCCAAGCTCAGG - Intronic
986687870 5:10289877-10289899 TCCAGCCGTGCACCATCCTCAGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987595114 5:19988153-19988175 AGCAGCTGTGCCCAGAGCTCTGG - Intronic
987957819 5:24763360-24763382 TTGAGCTGTGCCCCATCCTCAGG - Intergenic
988727195 5:33937349-33937371 AGCAGCTGTCCCCCAGGCTCCGG - Exonic
991314954 5:65291394-65291416 TCCAGCTGTGGCCCCAGGTCAGG - Exonic
992264609 5:75005983-75006005 TACAGCTGTGCAGCAAGCCCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
996672410 5:126134213-126134235 GCCAGCTGTGTCACTAGCTCAGG - Intergenic
998261698 5:140636613-140636635 ACCTGCTGTGCACCATGCTCTGG - Intergenic
998295621 5:140966693-140966715 CCCAGCCGTGCCCCACGCCCGGG - Exonic
998348716 5:141486859-141486881 TCCAGCTGTGCTCCGTCCTCGGG + Exonic
999250911 5:150181840-150181862 TCCTGCTGTGAGCCAAGCTCTGG - Intronic
999435357 5:151559394-151559416 CCCAGCTTGGCCCCAAGCTGAGG + Intronic
999775718 5:154811718-154811740 TCCAGCTGTGCCCCTAGCCCAGG + Intronic
1000568712 5:162883435-162883457 CCCAGTTGTGCCCCTAGCTCGGG - Intergenic
1001267840 5:170287975-170287997 TCCAGAAGTTCCCCAAGCTCCGG - Exonic
1001518465 5:172373709-172373731 ACCAACTGTGCACCAGGCTCTGG - Intronic
1002087026 5:176782406-176782428 TCCAGCTGTGCCTCATGCTGTGG - Intergenic
1002326150 5:178407945-178407967 TCCAGATGTGCCCAAAGACCTGG + Intronic
1002435595 5:179229016-179229038 TCCAGCTGTGCACCTCGGTCAGG + Intronic
1002435600 5:179229043-179229065 TCCAGCTGTGCACCTCGGTCAGG + Intronic
1002794127 6:457034-457056 TCCAGCTATGCTCCTAGCTAAGG + Intergenic
1003992403 6:11499113-11499135 TCCAGCTGTGATCCCACCTCTGG + Intergenic
1004749077 6:18542157-18542179 TCCAGCTGTGCCTAGAGCTAGGG + Intergenic
1005861425 6:29905548-29905570 CCCATCTGTGCCCCAAGACCAGG + Intergenic
1005899697 6:30206751-30206773 TCCAGAGGTGGCCCAGGCTCTGG + Intronic
1005916817 6:30359622-30359644 TGCAACTGTGCCCCAAATTCAGG + Intergenic
1006429652 6:33988017-33988039 TCCAGCTGATCCCGAAGCTCTGG - Intergenic
1009805048 6:68591555-68591577 TACAGCTGTGCCCCACTCTGTGG + Intergenic
1017106799 6:150895371-150895393 TCCAGCTGTGCCCTAACCACAGG - Intronic
1019588105 7:1815554-1815576 TCCAGCTCTGCCTCAAGGCCGGG - Intergenic
1020155559 7:5721068-5721090 TCCAGCTGTGCAACAAGAGCAGG - Exonic
1021631815 7:22654983-22655005 TCCAGCCGGGCCCCTGGCTCAGG - Intergenic
1023403832 7:39811295-39811317 TTCAGCTATGCCCAGAGCTCTGG - Intergenic
1023844717 7:44114127-44114149 TCCAGCTGGGTCTCAAACTCAGG - Exonic
1025200032 7:56956427-56956449 ACCAGCTATGCACCAGGCTCTGG + Intergenic
1025671912 7:63620505-63620527 ACCAGCTATGCGCCAGGCTCTGG - Intergenic
1026221162 7:68398827-68398849 CCCAGCCCTGCCCCTAGCTCAGG + Intergenic
1027718763 7:81710889-81710911 ACCTGCTGTGCCCCAGGCTCAGG - Intronic
1031076910 7:117221820-117221842 TCCAACTCTTTCCCAAGCTCTGG + Intronic
1032191843 7:129770139-129770161 TCCAGCTCTGCTCCAGGCTGTGG - Intergenic
1032336204 7:131027345-131027367 CCCAGCTCCGCCCCCAGCTCTGG + Intergenic
1032514176 7:132494841-132494863 TCCAGCAGTTCCCCAGGCTCAGG + Intronic
1033820103 7:145125013-145125035 TGCATCTGTGAACCAAGCTCAGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035171422 7:157019374-157019396 TCTGCCTGTCCCCCAAGCTCAGG - Intergenic
1036432309 8:8702300-8702322 CCCTGCCGTGCCCCAGGCTCCGG - Exonic
1037315787 8:17598187-17598209 TCTAGCTGTGCCTCAGCCTCTGG - Intronic
1039968333 8:42299776-42299798 TGCAGCTGTGCCCAAAGGACGGG - Intronic
1044128229 8:88485203-88485225 TCTAGCTGGGCCCAAAGCTATGG - Intergenic
1044602418 8:94018812-94018834 TTCAGCTGTGCCCCATGCATAGG - Intergenic
1045541414 8:103089738-103089760 ACCAGCCGTGTCCCAATCTCAGG + Intergenic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1047204906 8:122795304-122795326 GCCAGCTTTGTCCCAAGTTCAGG + Intronic
1049395716 8:142399344-142399366 TCCAGCTGTGGCCCAGGGCCTGG - Intronic
1049658033 8:143807406-143807428 TCCAGCTGGGCTCCAGGATCAGG - Intronic
1051367791 9:16333497-16333519 TCCACCTGTGGCCCCAGATCAGG - Intergenic
1053409103 9:37904137-37904159 TCGCGCTGCGCCCCAACCTCGGG - Intronic
1060051214 9:120379774-120379796 CCCAGCTCTGCCTCCAGCTCGGG + Intergenic
1060209282 9:121700041-121700063 TCAGGCTGTGCCCCCAGCTCAGG - Intronic
1060262994 9:122092561-122092583 TCCTGCGGTGCACCACGCTCGGG - Intronic
1060466948 9:123914935-123914957 TCAACCTGAGTCCCAAGCTCAGG + Intronic
1060483944 9:124035446-124035468 GCCCGCTGTGCCCCTTGCTCAGG + Intergenic
1060549396 9:124477940-124477962 TCCACCTGGGCCCCACCCTCCGG + Intronic
1060925888 9:127454816-127454838 TCCCTCTGGGCCTCAAGCTCTGG + Intronic
1061884330 9:133584017-133584039 TCTAGCTGTGCCCCACCCTCTGG + Intronic
1062035873 9:134382318-134382340 TCTGGCTGGGACCCAAGCTCAGG + Intronic
1062627437 9:137449657-137449679 TCCAGCTGTTCCAGAACCTCAGG - Exonic
1188857196 X:35210640-35210662 TACAGCAGTGCCCCACTCTCTGG + Intergenic
1189332733 X:40153327-40153349 TTCAGCTGTCCCCCACCCTCGGG - Intronic
1192155532 X:68743726-68743748 TTCAGCCTTGCCCCAACCTCAGG + Intergenic
1192190900 X:68990539-68990561 TCCAGCCCTGGCCCACGCTCTGG - Intergenic
1195969550 X:110458356-110458378 TCCAGCTGTGCCCCAAAGATTGG - Intergenic
1196189381 X:112779075-112779097 TCCAGCTGTGGCTCAGGCTGAGG - Exonic
1196988238 X:121298623-121298645 TCCAGCTGTACCCCCATCACAGG + Intergenic
1197734251 X:129839037-129839059 TCCAGATGTGCCTCAAGATTTGG + Intronic
1198302421 X:135344935-135344957 TCCAGCTGTGCCCCGGGCGGCGG + Intronic
1198631779 X:138647063-138647085 CCCAGCTGTGCTCAGAGCTCAGG + Intronic
1200121780 X:153794510-153794532 ACCAGCTGGGCCCCTGGCTCAGG + Exonic
1200159577 X:153999310-153999332 TGCAGGTGTGCACCACGCTCTGG + Intergenic