ID: 915005086

View in Genome Browser
Species Human (GRCh38)
Location 1:152628419-152628441
Sequence GAGGAGGCTCTTTGATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915005086_915005094 6 Left 915005086 1:152628419-152628441 CCACCTCATCAAAGAGCCTCCTC No data
Right 915005094 1:152628448-152628470 CTGTGCTTGGGCAATGCTGTGGG No data
915005086_915005089 -7 Left 915005086 1:152628419-152628441 CCACCTCATCAAAGAGCCTCCTC No data
Right 915005089 1:152628435-152628457 CCTCCTCCTTGCTCTGTGCTTGG No data
915005086_915005095 7 Left 915005086 1:152628419-152628441 CCACCTCATCAAAGAGCCTCCTC No data
Right 915005095 1:152628449-152628471 TGTGCTTGGGCAATGCTGTGGGG No data
915005086_915005090 -6 Left 915005086 1:152628419-152628441 CCACCTCATCAAAGAGCCTCCTC No data
Right 915005090 1:152628436-152628458 CTCCTCCTTGCTCTGTGCTTGGG No data
915005086_915005093 5 Left 915005086 1:152628419-152628441 CCACCTCATCAAAGAGCCTCCTC No data
Right 915005093 1:152628447-152628469 TCTGTGCTTGGGCAATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915005086 Original CRISPR GAGGAGGCTCTTTGATGAGG TGG (reversed) Intergenic
No off target data available for this crispr