ID: 915007842

View in Genome Browser
Species Human (GRCh38)
Location 1:152656408-152656430
Sequence CACCTTAGGAGGGCTCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915007842_915007850 4 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007850 1:152656435-152656457 GTTCAAGTCTCTTCCTGCTGTGG No data
915007842_915007857 28 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007857 1:152656459-152656481 CCTAGCTCTGGGACTGCTGTGGG No data
915007842_915007852 16 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007852 1:152656447-152656469 TCCTGCTGTGGGCCTAGCTCTGG No data
915007842_915007854 17 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007854 1:152656448-152656470 CCTGCTGTGGGCCTAGCTCTGGG No data
915007842_915007851 5 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007851 1:152656436-152656458 TTCAAGTCTCTTCCTGCTGTGGG No data
915007842_915007855 27 Left 915007842 1:152656408-152656430 CCCCTAAGAGCCCTCCTAAGGTG No data
Right 915007855 1:152656458-152656480 GCCTAGCTCTGGGACTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915007842 Original CRISPR CACCTTAGGAGGGCTCTTAG GGG (reversed) Intergenic
No off target data available for this crispr