ID: 915009856

View in Genome Browser
Species Human (GRCh38)
Location 1:152675466-152675488
Sequence GTTGAGGCTCTGAGGCCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915009851_915009856 17 Left 915009851 1:152675426-152675448 CCATACTGAGCAGGAATGGGACT 0: 1
1: 2
2: 1
3: 14
4: 111
Right 915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG 0: 1
1: 1
2: 0
3: 14
4: 159
915009853_915009856 -9 Left 915009853 1:152675452-152675474 CCTGCCTCGAATCTGTTGAGGCT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG 0: 1
1: 1
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915009856 Original CRISPR GTTGAGGCTCTGAGGCCTAC CGG Intronic
900318486 1:2070841-2070863 CTTGAGGCTCCGGGGCCTTCTGG + Intronic
902143754 1:14379264-14379286 GGTGAGACTCTGAGGCTTGCTGG + Intergenic
902411953 1:16217065-16217087 GTTCAGGCTCTGCCGCCGACCGG - Intergenic
902457793 1:16548295-16548317 GTCGAGGCGCTGAGGCCAAAGGG - Intergenic
902483420 1:16724998-16725020 GTCGAGGCGCTGAGGCCAAAGGG + Intergenic
902494367 1:16859618-16859640 GTCGAGGCGCTGAGGCCAAAGGG + Intronic
903740567 1:25556256-25556278 ATTGAGACTCTGAGGCTGACTGG + Intronic
908199812 1:61782705-61782727 GGAGAGGCTCTGAGGCTTACAGG - Intronic
910325796 1:86005115-86005137 GTTGTGGCTCTGAGAACAACTGG + Intronic
911586946 1:99702374-99702396 GTTCACTCTCTGAGGCCTTCAGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG + Intronic
915011013 1:152686294-152686316 GTTGAGGCTGTGAGGCCTACCGG + Intronic
920049829 1:203157092-203157114 GTTAAGACTTTGGGGCCTACTGG - Intronic
920676736 1:208043303-208043325 GTAGAGACTCTGAGGATTACGGG + Intronic
921479779 1:215650710-215650732 GTGGGGGCTCTGAGACCTTCTGG + Exonic
923967082 1:239154130-239154152 GTTAAGACTCTGGGGGCTACGGG + Intergenic
1069686738 10:70323686-70323708 TTTGAGGCCCTGTTGCCTACCGG - Intronic
1072396653 10:95049919-95049941 GGTAAGTCTCTGAGGCTTACCGG + Intronic
1075563117 10:123482856-123482878 GAGGGGGCTCTGAGGCCTAGGGG - Intergenic
1077017539 11:403567-403589 GGTGAGGGTCTGAGGCCTCCGGG + Intronic
1078556492 11:12331105-12331127 GTTGAGGCACTGTTACCTACTGG + Intronic
1079712838 11:23708173-23708195 GGTGAGCCTCTGAGACTTACTGG + Intergenic
1080707159 11:34707239-34707261 GTTGAGACTCTGAGACATGCTGG - Intergenic
1083339604 11:61950457-61950479 GCTGGGGCTTTGAGGCCTTCAGG + Intronic
1084161290 11:67351846-67351868 GTTGAGCCTCTGACACCTCCAGG + Exonic
1084235455 11:67785381-67785403 GCTGAGGATGGGAGGCCTACCGG - Intergenic
1086329364 11:85738178-85738200 GTTGAGGTTCTGTGGCCTTGGGG - Intronic
1087876938 11:103369842-103369864 GGTGAGGTTCTGAGGCTTACTGG + Intronic
1088921217 11:114260922-114260944 GTTGAGGAAGTGAGGCCTTCGGG - Intronic
1092290911 12:7158990-7159012 GTGGAGGCTCTGGGGCCTCAGGG + Intergenic
1100023215 12:90096801-90096823 TTTGAGGGTCTGAGGCTTTCTGG + Intergenic
1102097587 12:110252716-110252738 GTTGAGGCTCTGAGGACCCAAGG + Intergenic
1102888193 12:116537422-116537444 GTTGAGGCTCTGAGAGGGACTGG + Intergenic
1104781082 12:131420986-131421008 GTTGTGTCCCTGAGGGCTACAGG + Intergenic
1105460369 13:20579771-20579793 GGTGAGACTCTGAGATCTACTGG - Intronic
1107440598 13:40424200-40424222 GTTGAGGCCTTGAGGGCCACAGG + Intergenic
1112053805 13:95671360-95671382 GGTGAGACTCTGAGGTATACTGG - Intergenic
1112251438 13:97784220-97784242 GTTGAGACTTTGGGGGCTACTGG + Intergenic
1112940416 13:104854809-104854831 GGTGAGGCTCAGAGCCCTGCTGG + Intergenic
1113784538 13:112995580-112995602 GTTGTGGCTCCAAGGCCTGCTGG + Intronic
1116232455 14:42234935-42234957 GTTGAGGCTTTGGGGACTATTGG - Intergenic
1117148980 14:52866182-52866204 GTGTAGGCTCAGAGGCCTACAGG + Intronic
1118641247 14:67794476-67794498 CTTGGGGCTCTGAGACCCACAGG - Intronic
1121634190 14:95442711-95442733 GATGAAGCTCTGTGGCCTCCAGG + Intronic
1124252408 15:28115492-28115514 GTTGAGGCTCAGGGGACTCCCGG + Exonic
1124878125 15:33615308-33615330 CCTGAGGTGCTGAGGCCTACTGG - Intronic
1127132602 15:55882919-55882941 GGTGAGACTCTGAGACATACAGG + Intronic
1128725991 15:69989042-69989064 GTTGAGCCTCTGAGGGCAGCTGG - Intergenic
1130153720 15:81332263-81332285 GCTGAGGCCCTGAGGCTGACAGG - Exonic
1131381305 15:91966045-91966067 GACGAGGCTCTGATGCCTTCTGG - Intronic
1132195675 15:99913111-99913133 GTTGTGGCTCTGTGTCCTCCAGG + Intergenic
1132649728 16:1014984-1015006 CTGCAGGCTCTGAGGGCTACAGG - Intergenic
1133347020 16:5078015-5078037 GCTGAGGATGGGAGGCCTACCGG - Exonic
1135407248 16:22207028-22207050 GATGCGGCTCTGAGCCCTGCAGG - Intronic
1136114128 16:28083945-28083967 GGTGAGGCTGTGAGCCCTGCAGG + Intergenic
1136499916 16:30664943-30664965 GATGAGGCTCGGAGGCCTCTGGG + Intronic
1137578118 16:49617261-49617283 TCTGAGGCTCTGAAGCCCACTGG + Intronic
1140780344 16:78290459-78290481 GTTGAGCCTGTGAGCCCTACAGG - Intronic
1142667129 17:1469599-1469621 GCAGAAGCTCTGAGGCCTAAGGG + Exonic
1146615142 17:34350530-34350552 GGTGAGACTCTGAGACATACTGG + Intergenic
1146782235 17:35684757-35684779 CTTGAGGCTCTGTGGCCAATGGG - Intronic
1147168374 17:38605025-38605047 GCTGAGGCTCAGAGGTCTCCAGG + Intronic
1153241973 18:3039220-3039242 ATACAGGCTCTGGGGCCTACTGG - Intergenic
1158089167 18:53690605-53690627 ATTGAGGTCCAGAGGCCTACTGG - Intergenic
1159226826 18:65549149-65549171 GTTGAGGCACTGAAGCCTTATGG - Intergenic
1160409726 18:78667648-78667670 GATGAGGCCCTGAGGGCTGCTGG + Intergenic
1161339042 19:3730590-3730612 GTGGTGGCTCTGAGGCCAACGGG + Exonic
1161514783 19:4690324-4690346 CTCGGGGCTCTGAGGCCTCCCGG - Intronic
1161679537 19:5672938-5672960 CTGAAGGCTCTGAGGCCAACAGG + Intergenic
1162361814 19:10224906-10224928 GGTGGGGCTCAGAGGCCTGCTGG + Exonic
926908783 2:17830195-17830217 GGTGAGCGTCTGAGGCCTCCTGG + Intergenic
928747041 2:34427489-34427511 GATGAGGCTCTCAGGCATATAGG + Intergenic
928862465 2:35875152-35875174 GTTGAGCCTCTGAGACTTGCTGG - Intergenic
930393979 2:50796523-50796545 GTTAATTCTCTGAGGCCTAAAGG + Intronic
930727394 2:54695250-54695272 GGTGAGACTCTGAGTCTTACTGG + Intergenic
931343598 2:61426122-61426144 GTTGAGCCTCTGAGACTTGCTGG + Intronic
933901667 2:86854637-86854659 GCTGTGGCTCTGATGCCTACTGG + Intronic
935778881 2:106494631-106494653 GCTGTGGCTCTGATGCCTACTGG - Intergenic
942914991 2:181294536-181294558 GATGAGCCTCTGAGACTTACTGG + Intergenic
943226785 2:185188149-185188171 GATGAGACTCTGAGGCTTACTGG - Intergenic
943485465 2:188473897-188473919 GGTGAGACTCTGAGGCTTGCTGG - Intronic
947893091 2:233643671-233643693 GGTGAGCCTCTGAGACTTACTGG - Intronic
948462968 2:238139104-238139126 GGTGAGGCTCTGAGACCCTCAGG + Intronic
1169134815 20:3190836-3190858 GTTGTGGGGCTGAGGCCTCCTGG + Intronic
1171181711 20:23095718-23095740 GTTGAGGCTCCCAGGGCTGCAGG - Intergenic
1171574768 20:26297229-26297251 TTTGAAGCTTTGAGGCCTAAGGG + Intergenic
1172893749 20:38285147-38285169 GATGAGGAACTGAGGCCTCCTGG - Intronic
1173189199 20:40863277-40863299 GTTGAGAAGCTGAGGCCTGCAGG + Intergenic
1173395662 20:42677382-42677404 GTTGTGTCTCTGAGGGCTCCTGG - Intronic
1173430427 20:42982827-42982849 GTTGAGGATCTGATGACTGCAGG + Intronic
1173981469 20:47227330-47227352 GTTGAGCTTCTGAGCCCTCCTGG - Intronic
1174882781 20:54298833-54298855 GGTGAGGAGCTGAGGCCTCCTGG - Intergenic
1175262934 20:57686109-57686131 GTTGAGGCTCTGGGAGCTCCTGG - Intronic
1176520728 21:7822146-7822168 GTAGAGGCTCTGGGGCCAGCAGG - Intronic
1177132950 21:17279626-17279648 GGTGAGCCTCTGAGGCTTACTGG + Intergenic
1178896897 21:36566537-36566559 GTTGAGGCCCTGGGGCCTCACGG + Intronic
1180136657 21:45866529-45866551 GCAGAGGCTGTGAGGCCTCCAGG + Intronic
1180914897 22:19479187-19479209 GGTGAGCCTCTGGGGCGTACCGG - Exonic
1181571881 22:23772411-23772433 GTTGAGGCTCTGAGGGGTGGGGG + Intronic
1184635926 22:45831431-45831453 GATGAGGATCTGAGACATACAGG - Intronic
1185014145 22:48333684-48333706 GTGGAGGCTCCCAGGCCTCCCGG + Intergenic
950328299 3:12134434-12134456 GGTGAGGCTCTGGGCACTACAGG - Intronic
951423104 3:22510783-22510805 GATGAGGCTCTGAGACTTCCTGG + Intergenic
951771353 3:26261025-26261047 CTTGAGGTTATGAGGCCTTCAGG - Intergenic
954636681 3:52074713-52074735 GTCCAGGCTCTGAGGCATGCAGG + Intergenic
955014665 3:55058791-55058813 GCTCAGGCTCTGAGGCCAAATGG + Intronic
956352157 3:68349624-68349646 TTTTAGGCTTTGAGGCTTACAGG + Intronic
961885016 3:130091369-130091391 GCTGAGGGTGGGAGGCCTACCGG - Exonic
962688373 3:137868920-137868942 GGTGAGGCTCTGAGACTTGCTGG + Intergenic
964244246 3:154632856-154632878 GGTGAGCCTCTGAGTCTTACTGG - Intergenic
965047493 3:163597948-163597970 GGTGAGGCTCTGAGACTTTCTGG + Intergenic
968005006 3:195236714-195236736 GGTGAGACTCTGAGACCTGCTGG - Intronic
968994204 4:3935557-3935579 GCTGAGGATGGGAGGCCTACCGG - Intergenic
969473993 4:7410815-7410837 GGTTAGGCTCTGAGGCCTTGAGG + Intronic
969603519 4:8190420-8190442 GTTGGGGCTCTGAGGAGTTCGGG + Intronic
969819726 4:9710679-9710701 GCTGAGGATGGGAGGCCTACCGG + Intergenic
972851592 4:43057279-43057301 GGTGAGCCTCTGAGACTTACTGG + Intergenic
973908774 4:55557678-55557700 GTTGAGACTTTGGGGGCTACTGG - Intronic
973977447 4:56276798-56276820 ATTGAGGCTCTGATACTTACTGG + Intronic
976254210 4:83083612-83083634 GTTGAGCCTCTGAGACTTGCTGG - Intergenic
978261721 4:106768179-106768201 GGTGAGGCTCTGAGACCTGATGG + Intergenic
979323860 4:119356142-119356164 GTTTAGTCTCTAAGGCCTAAAGG - Intergenic
984179200 4:176461187-176461209 GTTGAAGATCTGACGCTTACAGG - Intergenic
985493425 5:192055-192077 GTGCAGGCTCTGAGGCCAGCGGG + Exonic
986063072 5:4209852-4209874 GTTGAGGTTTTAAGGCTTACAGG + Intergenic
989634449 5:43519589-43519611 GTTAAGGCTGTGAGGCCCAAGGG + Intergenic
993152890 5:84183299-84183321 GTTGATGCTCTGAGGGGTATAGG - Intronic
993364600 5:87020181-87020203 GTTGAGGGAGTGAGCCCTACCGG - Intergenic
997005234 5:129808711-129808733 TTTCACCCTCTGAGGCCTACTGG - Intergenic
998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG + Intergenic
1003437966 6:6111528-6111550 GGTGAGGCTCTGAGACTTGCTGG - Intergenic
1006802082 6:36765800-36765822 GTTGAGGGTCTGAGGGCTTTGGG + Intronic
1006811429 6:36822767-36822789 GCTGGAGCTCTTAGGCCTACTGG + Intronic
1007180184 6:39923853-39923875 GTTGAGGACCTGTGGCCCACTGG - Intronic
1007701314 6:43768136-43768158 ATGGAGGCTCTGAGCCCTAAGGG - Intergenic
1007701431 6:43768691-43768713 GTTGGGGCTCTGAGGCCTGTGGG - Intergenic
1008848525 6:55996587-55996609 GTTGAGGCTCTGAGACGTGCCGG - Intergenic
1008880747 6:56378096-56378118 GGTGAGACTCTGAGACTTACTGG + Intronic
1016118345 6:140316308-140316330 TTTGTGGCCCTGAGGCCTTCAGG + Intergenic
1020318487 7:6923923-6923945 GCTGAGGATGGGAGGCCTACCGG - Intergenic
1023137466 7:37066523-37066545 TTTGAGGCACAGAGGCCTACTGG - Intronic
1023372578 7:39526937-39526959 GGTGAGGAACTGAGGCCTCCAGG + Intergenic
1025997567 7:66537680-66537702 GTTGGGGCTCTGAGGTGTGCAGG - Intergenic
1028770773 7:94618227-94618249 GTTGAGGCACTGAGGAGTTCAGG + Intronic
1031231626 7:119114607-119114629 GGTGAGCCTCTGAGACTTACTGG - Intergenic
1032487466 7:132298525-132298547 GATGAGGCTCTGAGGCTTGGAGG + Intronic
1038285306 8:26201061-26201083 CTTGAGGTTGTGAGTCCTACTGG + Intergenic
1041869271 8:62615121-62615143 GGTGAGCCTCTGAGGCTTGCTGG - Intronic
1042726876 8:71888504-71888526 GTTGAGCCTCTGAGACTTGCTGG - Intronic
1043967534 8:86495630-86495652 GCTGAGGCTGTGCTGCCTACGGG - Intronic
1046268198 8:111858929-111858951 GTTGAGCCTCTGAGACTTGCTGG - Intergenic
1046680335 8:117162479-117162501 GTTTAGGGTCAGAGGCTTACCGG - Intronic
1049756479 8:144313324-144313346 GTGGAGGCTCTGTGCCCTGCAGG - Intronic
1060193195 9:121606003-121606025 GTTGAGTCTCAGAGGCCAAAAGG + Intronic
1061423907 9:130487363-130487385 GTTTTGACTCTGAAGCCTACCGG - Intronic
1061865965 9:133491935-133491957 GATGAGGCCCTGAGGCCTGGAGG + Intergenic
1062026208 9:134341923-134341945 GTTGAGGCTCTGCCCACTACTGG + Intronic
1062091023 9:134678930-134678952 GGTGAGGCTCCGAGGCTTGCTGG + Intronic
1062503658 9:136862001-136862023 GTTGTGGCTCAGAGGCCTCGGGG - Intronic
1185475601 X:413661-413683 GCTGGAGCTCTGAGGTCTACAGG + Intergenic
1189604480 X:42661647-42661669 GTTGAGTTTCTGTGGCCTTCTGG - Intergenic
1193337387 X:80306776-80306798 GTTGAGCCTCTGAGACTTGCTGG - Intergenic
1193488334 X:82115522-82115544 GATGAGCCTCTGAGGCTTTCTGG - Intergenic
1193760744 X:85462580-85462602 GTTGAGACTCTGAGACTTGCTGG + Intergenic
1194391385 X:93321910-93321932 GGTGAGCCTCTGAGACTTACTGG - Intergenic
1194925181 X:99816001-99816023 GGTGAGCCTCTGAGACCTGCTGG + Intergenic
1195014673 X:100766456-100766478 GGTGAGACTCTGAGACCTGCTGG - Intergenic
1195225051 X:102784346-102784368 GGTGAGACTCTGAGACTTACTGG - Intergenic
1196591068 X:117485583-117485605 GTTGAGCCTCTGAGACTTGCTGG - Intergenic
1199177668 X:144810797-144810819 GTTGAGCCTCTGAGGTTTACTGG + Intergenic
1199239134 X:145526274-145526296 GTTTAGCCTCTGAGGTCTGCTGG + Intergenic
1199317331 X:146395869-146395891 GGTGAGGCACTGAGACCTGCTGG - Intergenic
1200837619 Y:7748651-7748673 GTTCAGGCTCTGGGGCCTCTAGG - Intergenic
1202129873 Y:21599968-21599990 GCTGAGGCTGTGAGGTCTGCAGG + Intergenic