ID: 915010764

View in Genome Browser
Species Human (GRCh38)
Location 1:152684172-152684194
Sequence AGCATGTATGTCCAAACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915010764_915010766 -7 Left 915010764 1:152684172-152684194 CCCTATGTTTGGACATACATGCT 0: 1
1: 1
2: 1
3: 12
4: 178
Right 915010766 1:152684188-152684210 ACATGCTCCAAGAATGTTGTAGG 0: 1
1: 1
2: 1
3: 20
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915010764 Original CRISPR AGCATGTATGTCCAAACATA GGG (reversed) Intergenic
901249415 1:7764126-7764148 AGTATGCATGTCCAAAATTAGGG + Intronic
901425442 1:9179845-9179867 ACCAAGTAGGTCCTAACATAAGG + Intergenic
902682417 1:18052851-18052873 AGCATGTATATACATAAATATGG + Intergenic
906790177 1:48652381-48652403 AGCCTGTATCTTCATACATAAGG + Intronic
907957523 1:59244358-59244380 ACCAGGGATGTCCATACATAGGG - Intergenic
908275185 1:62463481-62463503 TACATGTATGTCCAGAAATAAGG + Intronic
909376268 1:74945591-74945613 ACCATGTATCTCTAAATATATGG - Intergenic
910731589 1:90403332-90403354 AGCATGTAAGTCAAGACATATGG - Intergenic
910869599 1:91820856-91820878 TGCATGTATGTGCATGCATATGG - Intronic
912022778 1:105126933-105126955 AGCAGATATGTCTAAACAGATGG + Intergenic
915008317 1:152661429-152661451 ATCATGTATGTCCAAACATACGG - Intergenic
915009603 1:152673310-152673332 ATCATGTATGTCCAAATATAGGG - Intergenic
915010764 1:152684172-152684194 AGCATGTATGTCCAAACATAGGG - Intergenic
915505123 1:156350388-156350410 TGTATCTATCTCCAAACATAAGG - Intronic
916243828 1:162666622-162666644 AGCATGTATGTAAAATCATCTGG + Intronic
916691203 1:167191655-167191677 AGCAAATATGTACATACATAGGG - Intergenic
917484408 1:175442444-175442466 AGCATTTATGTTCAATCCTAGGG + Intronic
919031345 1:192247065-192247087 AGCAGGTTTGCCCAAACAAAGGG + Intergenic
919429934 1:197480141-197480163 GGAATGTATGTCCAAATACATGG + Intergenic
919794843 1:201315389-201315411 ACCAAGTATGTCAAAGCATAAGG + Intronic
922111041 1:222555795-222555817 AGAATGTATATCAAAACATCAGG + Intergenic
922489443 1:226004025-226004047 ATCATGTTTGACCAAACATCTGG + Intergenic
923612596 1:235508227-235508249 AACCTGTATGTCCAATAATACGG - Intergenic
1064687071 10:17873990-17874012 AGCTCATATGCCCAAACATAAGG + Intronic
1069112181 10:64461719-64461741 AGCATGTATATCCAAGGAGAAGG - Intergenic
1070689894 10:78516702-78516724 AGCATTTCTGTCAAAACAAAAGG + Intergenic
1072090495 10:92122190-92122212 AGCAGATTTGTCCAAACATCAGG + Intronic
1073982316 10:109168715-109168737 AAAATGTTTGTCCAAACATCTGG - Intergenic
1074155651 10:110796852-110796874 AGCCTGAATGTCCAACAATAGGG - Intronic
1075020827 10:118950971-118950993 CACATGAATGTCCAAACACATGG + Intergenic
1075666692 10:124235898-124235920 AGCATGTGTGTCTACACATAAGG - Intergenic
1084449557 11:69227920-69227942 AGAATGTATGACCAAATATCTGG + Intergenic
1085596236 11:77812970-77812992 AGAATGTTTGTCCAAAATTAAGG - Intronic
1086052656 11:82612181-82612203 AGCATGCATCTCCTAAAATAAGG - Intergenic
1087252216 11:95915472-95915494 AGCATATAATTTCAAACATAAGG - Intronic
1087564399 11:99835806-99835828 AGCATGTATTTCCAGGCCTAGGG - Intronic
1087582828 11:100080641-100080663 AGCATGTAGGTGGAAACAAAGGG - Intronic
1088600541 11:111470553-111470575 AGCATGTTTACCCAAACTTATGG + Intronic
1094309990 12:29069778-29069800 ATAATGTTTGACCAAACATATGG + Intergenic
1097215496 12:57408369-57408391 AGCATGTATCTAAAAAAATAAGG - Intronic
1097406479 12:59196270-59196292 AATATGTATTTCCAAACATAAGG - Intergenic
1099545899 12:83979134-83979156 AACATGGATGTCCAAACTTTTGG + Intergenic
1099968796 12:89479521-89479543 TGAATGTATTTCCAAATATATGG + Intronic
1100039317 12:90294080-90294102 AGCATAAATGTCTAATCATATGG - Intergenic
1100683981 12:96965438-96965460 TGCATATATGGCCAAATATAGGG + Intergenic
1106380122 13:29228618-29228640 AGCATATATGTACACACACAGGG - Intronic
1108488584 13:50954590-50954612 AACCTATATGTCCAAATATAGGG - Intronic
1109358305 13:61262561-61262583 AGCAAATATGTCCAGACAAAAGG + Intergenic
1109795358 13:67305110-67305132 AGGATATATGTCCACATATATGG + Intergenic
1110400781 13:75089069-75089091 AGCATATATGTACAGACACATGG - Intergenic
1111529065 13:89513070-89513092 AGTATTTATATCCAAAGATAAGG + Intergenic
1111837532 13:93407145-93407167 ATCATGTTTCTCCAAAAATAAGG - Intronic
1112860353 13:103823239-103823261 AGCTTGTATTTCCATACATGTGG - Intergenic
1113366437 13:109681030-109681052 AACATGTGTTTCCAAACACAAGG + Intergenic
1113643435 13:111974962-111974984 GGCATGTATGTACACAGATATGG + Intergenic
1113820888 13:113211728-113211750 AGAATATATGTCCAAACAAAGGG - Intronic
1114793921 14:25690678-25690700 ACCATCTATATCTAAACATATGG - Intergenic
1115432240 14:33332703-33332725 AGCATCTATGTGCACCCATATGG + Intronic
1117131565 14:52692550-52692572 AACTTGTATTTCCAAACATCTGG + Intronic
1117931244 14:60842698-60842720 AGCATTTATATTCAAACAAATGG - Intronic
1119109536 14:71958671-71958693 AGCATGTCTGCCCAAACATCAGG + Intronic
1119527230 14:75332528-75332550 AGAATGTATCTCTAAAGATAAGG + Intergenic
1127130464 15:55856806-55856828 AGCATGTATAGAAAAACATAAGG - Intronic
1130625844 15:85513647-85513669 AGTATGTATTTCCTAAAATAGGG + Intronic
1135745606 16:25014494-25014516 AGCATTTGTTTCCAAACCTAAGG + Intronic
1138893411 16:61173554-61173576 AGCATGCATCTCCTAAAATAAGG - Intergenic
1140066699 16:71617332-71617354 AGCATGTATTACCAAACTTTTGG - Intergenic
1144347517 17:14362891-14362913 AGCATGGATGTCCAATCTTTTGG - Intergenic
1146904836 17:36611547-36611569 AGAATGTTTGACCAAACATCTGG - Intergenic
1151071266 17:71215192-71215214 ACCATGTCTGGCCAAACACAAGG + Intergenic
1151430856 17:74061750-74061772 AGCATAGGTGTCGAAACATAGGG - Intergenic
1151883618 17:76910439-76910461 TGCATGTATGTGCACACATGTGG - Intronic
1156041906 18:32832618-32832640 AGGATGTTTGTCCAGACATAAGG + Intergenic
1156108684 18:33696841-33696863 ATGATGTATCACCAAACATATGG + Intronic
1158046877 18:53166851-53166873 AGCATTGATTTCCAAACCTATGG + Intronic
1159007496 18:63025649-63025671 TGCCTGTTGGTCCAAACATAAGG + Intergenic
1162538636 19:11279652-11279674 AGGGTGTATGTCCAAGAATAAGG - Intergenic
1165584936 19:36906319-36906341 ATCATGTATAACCAAACACAGGG + Intronic
925054364 2:845521-845543 AGCAGGTATGTTCCAAGATAAGG + Intergenic
925915548 2:8602157-8602179 AGCATAAATGTCCAATAATAAGG + Intergenic
926628677 2:15117549-15117571 AACAGGTATTTCCAAACTTAAGG - Intergenic
926798667 2:16640059-16640081 AGCCTGTATGTGCTAACAGATGG - Intronic
927087867 2:19689185-19689207 AGCGTGTATGTCTAAATAAATGG + Intergenic
927283442 2:21332060-21332082 AGAATGTTTGACCAAACATCTGG - Intergenic
927354161 2:22153995-22154017 ATAATGTATGCCCAAACAAAAGG + Intergenic
929218674 2:39441165-39441187 AGCATGTATGTGAAATAATATGG + Intergenic
932262234 2:70336686-70336708 AGCAGGTATATTCAAACTTAAGG - Intergenic
933425219 2:82102814-82102836 AGGATGTATGTCCTGACATCAGG - Intergenic
938452569 2:131435211-131435233 ATCATGTATGTCCCTATATAGGG - Intergenic
938566634 2:132524604-132524626 AGCATCTTTGTCCCAAAATACGG + Intronic
944940264 2:204617504-204617526 AGCATGAATGTACAAGCATGTGG + Intronic
946134034 2:217630970-217630992 AGTATGCATGTCCCATCATAAGG + Intronic
1169401150 20:5281888-5281910 AGCATATATGTCCAGCCAGAGGG + Intergenic
1169882525 20:10362695-10362717 CACATGTATGGCCACACATAAGG - Intergenic
1171137298 20:22708292-22708314 AGCATGTGTGTGCACACATTGGG + Intergenic
1172502261 20:35436027-35436049 AGCATGTGTGTATAAACATAAGG + Intronic
1175302790 20:57954727-57954749 ATGATGTATGACCACACATATGG + Intergenic
1176068588 20:63214300-63214322 AGAATGTATGCCCAAACGTATGG + Intronic
1177485974 21:21756586-21756608 AGGATGTATGACCAAACAACTGG + Intergenic
1182159723 22:28109384-28109406 AGTAAGTATGTCCATACACACGG + Intronic
1183012436 22:34957930-34957952 AGCATGCATGTCCCAGCAAAGGG + Intergenic
1184904478 22:47471601-47471623 TGGATATATGTCTAAACATATGG + Intronic
951512801 3:23522776-23522798 ACCATATATGCCAAAACATAAGG - Intronic
952585564 3:34887945-34887967 AGCACGTATTTCCAAACACAGGG - Intergenic
952723990 3:36562628-36562650 AGTATGTATGTGGAAAAATAGGG - Intergenic
952983066 3:38754096-38754118 AACATGTATGTGCAAAGACAGGG - Intronic
953292621 3:41681389-41681411 AGCATATGTGTATAAACATAAGG + Intronic
953582091 3:44166670-44166692 AGAATGTTTGACCAAACATCTGG + Intergenic
955488070 3:59454776-59454798 AGGATGTATGTGCATACAGAGGG - Intergenic
957397027 3:79654537-79654559 GGCATGTGTTCCCAAACATAAGG - Intronic
957614978 3:82515642-82515664 AGCAGGGATGTCCAATCATTTGG + Intergenic
958924797 3:100145892-100145914 AGAATGTATGACCAAATATCGGG + Intronic
959667745 3:108940668-108940690 AGCTTGTATTTCCAAACGAAAGG - Intronic
960463599 3:117967857-117967879 AGCATGTATGAATAAATATATGG + Intergenic
961521885 3:127471851-127471873 AGAATGAATGTCCAAAAGTATGG + Intergenic
963180462 3:142350077-142350099 ATGATGTATGTCCAACCATTTGG - Intronic
965006415 3:163032006-163032028 ACTATGTGTCTCCAAACATATGG + Intergenic
967046310 3:185740198-185740220 ACCATGTATGTCCACACAATTGG + Intronic
969341869 4:6547233-6547255 AGCATGCATCTCTAAAAATATGG + Intronic
971526966 4:27631875-27631897 AGCATGTAGGTCTTCACATATGG - Intergenic
974425361 4:61736188-61736210 TGTATGTATGTACATACATATGG + Intronic
976042945 4:80908859-80908881 AACATGTATTTTCAAACATTTGG - Intronic
976190857 4:82485308-82485330 AGCGTGTATTTCGACACATAAGG + Exonic
976651730 4:87442284-87442306 TGTATGTATATCTAAACATAGGG + Intronic
977686966 4:99858038-99858060 AGTGTGTATTTCCAAAAATAAGG + Intronic
977893157 4:102335214-102335236 AGCATGCATCTCTTAACATAAGG + Intronic
983561512 4:169106409-169106431 AGCAGGTATGTCCAATCTTTTGG - Intronic
984762111 4:183371381-183371403 ATAATGTATGACCAAACATTTGG + Intergenic
985964430 5:3329234-3329256 AGCATATTTGTCCCAACAGAAGG - Intergenic
986286721 5:6364706-6364728 AGCTTGTAAGTACATACATATGG + Intergenic
987670410 5:21000020-21000042 AGCAAGTATTTCTAAAAATAGGG + Intergenic
988195947 5:28005740-28005762 ATCTTTTATGGCCAAACATATGG + Intergenic
990011918 5:51009486-51009508 AGCATGTGTCTCCAAAAATGGGG + Intergenic
994599004 5:101877887-101877909 ATCGTGTAGGTCCAGACATAAGG + Intergenic
997528329 5:134567532-134567554 AGCATGTATGTCTGAACCCAGGG - Intronic
1000390920 5:160722536-160722558 AGCAAGCATGTCAAAACACAGGG + Intronic
1001468457 5:171989982-171990004 AGCATGTATCTCCTAAAATAAGG - Intronic
1003746213 6:9005317-9005339 AGCATGGATATGTAAACATAGGG - Intergenic
1004965431 6:20844265-20844287 AGCATATATATTCAAATATATGG - Intronic
1005709291 6:28488148-28488170 AGCAGTGAGGTCCAAACATAGGG + Intergenic
1006768326 6:36529197-36529219 AGTATGCATTTCCAAAAATATGG - Intronic
1008232825 6:49005298-49005320 ATCATGTATGTACAAATATGTGG - Intergenic
1009286905 6:61829943-61829965 AGCATGTATGAGCAGGCATATGG - Intronic
1010141634 6:72621020-72621042 AGCTTGTATGTTACAACATAAGG + Intergenic
1010673587 6:78716164-78716186 AGAATGTTTGTCCAAATATCTGG - Intergenic
1011070978 6:83382859-83382881 AGAATGTTTGACCAAACATCTGG - Intronic
1012367069 6:98454478-98454500 AGCATGTATGTCTGTAAATACGG - Intergenic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1017583593 6:155895305-155895327 ACCATATATTCCCAAACATAAGG + Intergenic
1018538426 6:164849365-164849387 AGTTGGTATGGCCAAACATAGGG + Intergenic
1020053220 7:5097309-5097331 AGCATATATATCCAAAGAAAAGG - Intergenic
1020770771 7:12390969-12390991 ATCCTGAATGTCCACACATATGG + Intronic
1021003684 7:15366510-15366532 AGCATGTGAGTCCCCACATATGG + Intronic
1021727444 7:23562818-23562840 AGCAGGTTTGCCCAAACAAAGGG + Intergenic
1022569357 7:31436246-31436268 AACATAAATGTCCAAAAATAGGG + Intergenic
1023451639 7:40292136-40292158 AGAATGTATGTATATACATATGG - Intronic
1023770457 7:43552178-43552200 AGCATCCAGGTCCAAACACATGG - Intronic
1026370266 7:69691616-69691638 AGCATGTACTTCCAAGCCTATGG + Intronic
1028434223 7:90782799-90782821 AGCATTTTTGTCTCAACATAAGG + Intronic
1031194803 7:118599786-118599808 AACATATATGTGCAAATATAGGG + Intergenic
1038299669 8:26331696-26331718 AGCACGTATCTACAAACAAATGG - Intronic
1042799926 8:72707587-72707609 AGCATTCATCTCCACACATACGG + Intronic
1044980057 8:97707708-97707730 AGCATGTCTGTCAATACAAAGGG + Intronic
1045768671 8:105707823-105707845 AACATATATGACCAAAAATAGGG + Intronic
1047255760 8:123212407-123212429 AGAATGTTTGTCCAAATATCTGG - Intergenic
1047909569 8:129513051-129513073 ACCATGTATATACATACATAGGG + Intergenic
1051402671 9:16700032-16700054 GGCATATATGTGTAAACATAAGG - Intronic
1054813816 9:69455718-69455740 AGCAGGTCTGTCCAAGCATGAGG - Intronic
1055172958 9:73283404-73283426 AGCATGTTTGACCAAACATCTGG - Intergenic
1058071693 9:100607837-100607859 AGCATGTAAATACATACATAGGG - Intergenic
1058631958 9:106998452-106998474 AGCATGTATTTCCATACTTCTGG - Intronic
1062560714 9:137140477-137140499 AGCATGTGTGTCCACAGATGTGG - Intronic
1186284479 X:8028645-8028667 AGCAAATATGTCCTAATATAAGG + Intergenic
1189402284 X:40681933-40681955 AGCAGGTATGTCTAAACAGAAGG + Exonic
1190176003 X:48150267-48150289 AGCATGCATTTCCAAACACTGGG - Intergenic
1190182128 X:48201683-48201705 AGCATGCATTTCCAAACAGTGGG + Intronic
1190183112 X:48210706-48210728 AGCATGCATTTCCAAACAGTGGG - Intronic
1190186683 X:48240977-48240999 AGCATGCATTTCCAAACAGTGGG - Intronic
1190187508 X:48248704-48248726 AGCATGCATTTCCAAACAGTGGG + Intronic
1190191999 X:48284868-48284890 AGCATGCATTTCCAAACAGTGGG + Intergenic
1190201268 X:48363478-48363500 AGCATGCATTTCCAAACAGTGGG + Intergenic
1190202602 X:48376401-48376423 AGCATGCATTTCCAAACACTGGG - Intergenic
1190207936 X:48419009-48419031 AGCATGCATTTCCAAACACTGGG + Intergenic
1190656391 X:52616480-52616502 AGCATGCATTTCCAAACAGTGGG + Intergenic
1190668103 X:52713955-52713977 AGCATGCATTTCCAAACAGTGGG + Intergenic
1190671314 X:52744449-52744471 AGCATGCATTTCCAAACAGTGGG - Intergenic
1195937219 X:110137300-110137322 AGACTGTAGGTCCCAACATAGGG + Intronic
1195994370 X:110716944-110716966 AGCATCTAAGTCCGACCATATGG - Intronic
1196038870 X:111178879-111178901 AGCATATATGCTCAAATATAAGG + Intronic
1196277892 X:113790073-113790095 AGCATGTATGACCAGAGTTAGGG - Intergenic
1197675564 X:129326220-129326242 ATCATGTATGACCAAATGTATGG + Intergenic
1198204803 X:134455727-134455749 AGAATGTTTGACCAAATATATGG + Intergenic
1201264705 Y:12194482-12194504 AGCATATATTACCATACATATGG - Intergenic