ID: 915011100

View in Genome Browser
Species Human (GRCh38)
Location 1:152686992-152687014
Sequence ACCACAGCAGCCCCCAGAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 416}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915011100_915011111 15 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011111 1:152687030-152687052 TGCTGCAACTCTGGGGCTGGTGG 0: 1
1: 1
2: 6
3: 41
4: 485
915011100_915011108 7 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011108 1:152687022-152687044 CTGGGGGCTGCTGCAACTCTGGG 0: 1
1: 6
2: 7
3: 35
4: 256
915011100_915011110 12 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011110 1:152687027-152687049 GGCTGCTGCAACTCTGGGGCTGG 0: 1
1: 1
2: 11
3: 40
4: 347
915011100_915011109 8 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011109 1:152687023-152687045 TGGGGGCTGCTGCAACTCTGGGG 0: 1
1: 8
2: 8
3: 22
4: 261
915011100_915011107 6 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011107 1:152687021-152687043 TCTGGGGGCTGCTGCAACTCTGG 0: 1
1: 7
2: 2
3: 34
4: 252
915011100_915011103 -10 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011103 1:152687005-152687027 CTGCTGTGGTCCCAGCTCTGGGG 0: 4
1: 2
2: 14
3: 162
4: 2474
915011100_915011104 -9 Left 915011100 1:152686992-152687014 CCATCTCTGGGGGCTGCTGTGGT 0: 1
1: 0
2: 8
3: 46
4: 416
Right 915011104 1:152687006-152687028 TGCTGTGGTCCCAGCTCTGGGGG 0: 4
1: 2
2: 13
3: 96
4: 991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915011100 Original CRISPR ACCACAGCAGCCCCCAGAGA TGG (reversed) Exonic
900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG + Intergenic
900673343 1:3869382-3869404 ACCACACCAGCCCCCAGGCTGGG - Intronic
900828609 1:4947638-4947660 ACTACAGCAGCCAGCAGTGAAGG - Intergenic
900955421 1:5883647-5883669 CCCACTGCAGCCCACAGTGAAGG - Intronic
901069760 1:6511296-6511318 ACCCCAGCAGCACCCAGGGCTGG - Intronic
901817620 1:11803766-11803788 ACCAGATCACCCTCCAGAGAAGG + Intronic
901845501 1:11979794-11979816 TCCACAGCAGTCCCAGGAGAGGG - Intergenic
903732420 1:25506232-25506254 AGAACAGCATCTCCCAGAGAGGG + Intergenic
903961321 1:27059520-27059542 AGCACATGAGCCCCCAGAGCTGG + Intergenic
904578536 1:31522578-31522600 ACCACAGCAGTCCCCACAGCTGG - Intergenic
904609376 1:31716619-31716641 AACACAGAAAGCCCCAGAGAGGG - Intergenic
904720382 1:32503289-32503311 ACCACATGAGGCCCCAGACACGG + Intronic
905027284 1:34859542-34859564 ACCAGAACACCCGCCAGAGAGGG + Intronic
905547045 1:38808162-38808184 GCCACATCAAGCCCCAGAGAGGG + Intergenic
905705075 1:40049863-40049885 AGCACAGCAGCATTCAGAGAAGG - Intronic
906314187 1:44775753-44775775 GCCTTCGCAGCCCCCAGAGACGG - Intronic
906642750 1:47451160-47451182 CCCACAGCAGGCTCCAGAGCTGG - Intergenic
909232235 1:73105579-73105601 ACAACAGCCTCCCCCAGACATGG + Intergenic
909486642 1:76181055-76181077 CCCACAGCAGCGTCCAGGGATGG - Intronic
910481315 1:87661364-87661386 ACAGCAGCAGCCCCCAGAAGGGG + Intergenic
911500912 1:98683389-98683411 ACCACAGCACCCACCATAGTTGG - Intronic
912383030 1:109257820-109257842 CCCACAGCAGCCCAGAGAGTTGG + Intronic
914200720 1:145482600-145482622 ACCAGAGCAGCCCCCAGAGGGGG - Intergenic
914202612 1:145499483-145499505 GCCACAGCATGCCCCAGTGAGGG + Intergenic
914236542 1:145817411-145817433 GCCACAGCATGCCCCAGTGAGGG + Intronic
914479833 1:148055728-148055750 ACCAGAGCAGCCCCCAGAGGGGG - Intergenic
914481735 1:148072634-148072656 GCCACAGCATGCCCCAGTGAGGG + Intergenic
914936243 1:151983075-151983097 CCCACAGCTTCCCCCATAGAAGG - Exonic
914992596 1:152511695-152511717 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915006650 1:152644542-152644564 GCTGCAGCAGCCCCCAGAGCTGG + Intergenic
915008656 1:152664254-152664276 ACCACAGCAGCTCCCAGAGCTGG - Exonic
915008662 1:152664278-152664300 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915009940 1:152676164-152676186 ACCACAGCAGCTCCCAGAGCTGG - Exonic
915009946 1:152676188-152676210 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915011100 1:152686992-152687014 ACCACAGCAGCCCCCAGAGATGG - Exonic
915012316 1:152699038-152699060 GCCGCAGCAGCCCCCAGAGCTGG - Exonic
915012321 1:152699062-152699084 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915017118 1:152744450-152744472 GCTGCAGCAGCCCCCAGAGCTGG - Intronic
915020741 1:152776532-152776554 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915021936 1:152787460-152787482 GCCACAGCTGCCCCCAGAGCTGG - Exonic
915021941 1:152787484-152787506 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915022899 1:152797943-152797965 GCCACAGCCGCCCCCAGAGCTGG - Exonic
915022904 1:152797967-152797989 GCTGCAGCAGCCCCCAGAGTTGG - Exonic
915023596 1:152805272-152805294 ACTGCAGCATCCCCCAGAGCTGG + Exonic
915023601 1:152805296-152805318 GCCACAGCTGCCCCCAGAGCTGG + Exonic
915024265 1:152812607-152812629 GCCACAGCTTCCCCCAGAGCTGG - Exonic
915024270 1:152812631-152812653 ACTGCAGCAACCCCCAGAGCTGG - Exonic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
917511170 1:175670362-175670384 ACCACAGCATCCCTCAGAAGAGG + Intronic
918928157 1:190814586-190814608 CCCACAACAGTCCCCAGAGGGGG - Intergenic
919814654 1:201429839-201429861 GCCCCAGCAGGCCCCAGGGAAGG - Intronic
920211155 1:204329383-204329405 ACCACAACACCTCCCAGAGAAGG + Intronic
920551781 1:206867638-206867660 TCCAGAGCATCACCCAGAGAGGG - Intronic
920698887 1:208202994-208203016 TCCCCAGCAGACCCCAGGGAAGG - Intronic
920840750 1:209551707-209551729 CCCAGATCAGCACCCAGAGAGGG + Intergenic
922051449 1:221994386-221994408 AGCACAGCAGACCTCAGGGAAGG + Intergenic
922567276 1:226608877-226608899 ACCTAAGCAGCTCCCAGGGAAGG - Exonic
923078475 1:230631401-230631423 ACCATACTAGACCCCAGAGATGG + Intergenic
923089460 1:230728704-230728726 TCCACAGCAGCATACAGAGAAGG + Intergenic
923462483 1:234219192-234219214 ATCTCAGCTGCCCCCAGAGTAGG + Intronic
923762854 1:236863038-236863060 ACCACAACAGCCCAGACAGAGGG - Intronic
924054618 1:240113166-240113188 ACCACAGTATCCCCCAGTCAAGG - Intronic
924486997 1:244494433-244494455 CCCACAACAGTCCCCAGAGTGGG - Intronic
924780401 1:247141941-247141963 AGCACAGAGGCCCCCAGAGCTGG - Intronic
1063543721 10:6960483-6960505 ACCAAGCCAGTCCCCAGAGAGGG + Intergenic
1064102755 10:12477548-12477570 ACCACTGCAGACTCCAGAGCAGG + Intronic
1065940909 10:30563245-30563267 ACCACATCCACCCCCAGTGATGG - Intergenic
1066324607 10:34345099-34345121 ATCTCAGCATTCCCCAGAGAGGG + Intronic
1067419679 10:46134758-46134780 CCCAGAGCTGCCCCCAGAGCTGG - Intergenic
1067426339 10:46214653-46214675 CCCAGAGCTGCCCCCAGAGCTGG + Intergenic
1067505031 10:46841355-46841377 TCCAGAGCTGCCCCCAGAGCTGG - Intergenic
1070773374 10:79095806-79095828 ACCCCAGCAGCCCCAAGATGTGG - Intronic
1070828064 10:79402597-79402619 ACCAGAGCAGCCCCCTCACATGG - Intronic
1071261385 10:83922601-83922623 TCCAAAGGAGTCCCCAGAGAAGG + Intergenic
1072528532 10:96296378-96296400 ACCACAGCATCCACTACAGAGGG + Intergenic
1073065400 10:100755839-100755861 ACAGGAGCAGCCCCTAGAGAAGG + Intronic
1073084954 10:100882408-100882430 TCCCCACCAGCCCCCCGAGAAGG - Intergenic
1073327145 10:102649664-102649686 AGCCCGGCAGACCCCAGAGAGGG - Intronic
1073581277 10:104667878-104667900 AGCACAGCAGCTCCCAGAGGAGG - Intronic
1073954918 10:108859251-108859273 CCCACAACAGTCCCCAGAGTGGG - Intergenic
1074140984 10:110672457-110672479 ACGGCAGCAGCCCGGAGAGAAGG - Intronic
1074184379 10:111088107-111088129 CTCCCAGGAGCCCCCAGAGAGGG + Intergenic
1074681630 10:115913309-115913331 TCCACACCAGCCCCCAAAGGTGG + Intronic
1075380834 10:122017280-122017302 ATCACAGCAGCGCACACAGATGG + Intronic
1075589391 10:123680362-123680384 CCTACAGCACCCCCAAGAGATGG + Intronic
1075795063 10:125114392-125114414 AGAACCGCAGCACCCAGAGATGG + Intronic
1075967613 10:126626217-126626239 ATCACAGAAGGCCCCAGGGAAGG + Intronic
1076818849 10:132928158-132928180 TCCACAGCAGCCCTTGGAGATGG + Intronic
1077220598 11:1413790-1413812 GCCACTGATGCCCCCAGAGATGG - Intronic
1077239582 11:1503518-1503540 GCCACAGGAGCCCACAGAGCCGG + Intergenic
1077373344 11:2193844-2193866 TTCATAGCAGCCCCCAGCGAGGG - Intergenic
1077510772 11:2961011-2961033 ACCAAGGCAGCTCCTAGAGAGGG - Intronic
1078443185 11:11384593-11384615 ACCACAGCAGCCCTCATAAATGG + Intronic
1080692952 11:34574336-34574358 ATCACAGAAGCCTCCTGAGAAGG + Intergenic
1080826333 11:35852207-35852229 ACTCCAGCAGCCAGCAGAGAAGG - Intergenic
1081747034 11:45480683-45480705 CCCACAGCTGTCCCCAGGGAAGG + Intergenic
1081861529 11:46335846-46335868 AGGACAGCAGCCACAAGAGAGGG - Intronic
1082246308 11:49927203-49927225 CCCACAACAGTCCCCAGAGTGGG + Intergenic
1082997067 11:59263087-59263109 ACCACAGCAGCCCCCTGGCAGGG - Intergenic
1083221990 11:61258704-61258726 CCCCCAGCAGCCCCCAGTGGGGG - Exonic
1083306816 11:61765793-61765815 ACCACAGCAGACCCCAGGTCCGG - Intronic
1083755211 11:64788546-64788568 AACAGACCAGCCCCCAGGGAGGG - Intergenic
1084761374 11:71273596-71273618 AGCAGAACAGACCCCAGAGATGG + Intergenic
1085534323 11:77208938-77208960 ACCACTGGAGCCCCAAGGGATGG + Intronic
1085857619 11:80193315-80193337 CCTGCAGCAGCCCCCAGAGCTGG + Intergenic
1089202189 11:116731269-116731291 CCCACAGCTGCCCCGACAGAGGG - Intergenic
1089677404 11:120099059-120099081 CCCACAGCAGCCTCCAGGAAAGG + Intergenic
1089735782 11:120549495-120549517 GCCACTGCAGCCCCCCGTGAAGG - Intronic
1091232312 11:133996653-133996675 CACACAGCTGTCCCCAGAGAGGG + Intergenic
1091786883 12:3248359-3248381 ACAGCAGCAGCCCCAAGAAAGGG - Intronic
1092002488 12:5044018-5044040 ACCCCAGCTCTCCCCAGAGAGGG + Exonic
1092134676 12:6138374-6138396 GCCACAGAAGCACCCAGAGGTGG - Intergenic
1092164705 12:6335887-6335909 ACAACAGCAGCCCCCGCAGGTGG + Intronic
1094636519 12:32231749-32231771 CCCACAACAGTCCCCAGAGTGGG + Intronic
1095883823 12:47167764-47167786 AAAACAGCAGAGCCCAGAGAGGG + Intronic
1095952126 12:47787272-47787294 ACCCAAGCAGGCCCCAGAGTTGG - Intronic
1097178305 12:57156356-57156378 CCCACAGGAGGGCCCAGAGAGGG - Intronic
1101497159 12:105265642-105265664 ACAGAACCAGCCCCCAGAGAGGG + Intronic
1101778183 12:107812901-107812923 CCCACATCAGCCCCGAGAGATGG + Intergenic
1102699283 12:114825217-114825239 ACCACACCCGGCCCCAGGGAAGG - Intergenic
1103013349 12:117475011-117475033 ACATCAGCAGCACCCAGAGGAGG - Intronic
1103048399 12:117758492-117758514 ACCACAGCATCCCCCAAGGTGGG + Intronic
1103791677 12:123476639-123476661 CCCCCAGCAGCCACCAGAAATGG + Intronic
1103927629 12:124432686-124432708 ACCCCAGCAGCTCCCAGAGAGGG + Intronic
1104820129 12:131672352-131672374 ACCAGTGCAGTCCCCAGAGCTGG + Intergenic
1106858273 13:33875903-33875925 ATCATAGCAGCCCTCTGAGAGGG + Intronic
1109190763 13:59320693-59320715 ACCGCAGCAGCCCTGTGAGATGG + Intergenic
1109194559 13:59363814-59363836 ACCACAGAAGTTCTCAGAGAAGG + Intergenic
1109928979 13:69187199-69187221 CCCACCTCAGCCTCCAGAGATGG + Intergenic
1111197613 13:84894976-84894998 CCCACAGCCAGCCCCAGAGATGG + Intergenic
1111886704 13:94030366-94030388 GCCACAGCAGAACCCAAAGAAGG - Intronic
1112491004 13:99863821-99863843 CCCACCCCAGCCCCCACAGAGGG + Intronic
1113032487 13:106009877-106009899 TCCAAATCAGCCCCTAGAGAAGG + Intergenic
1114396015 14:22362483-22362505 AGCACAGTAGCCCCCAGCAATGG - Intergenic
1114431907 14:22669047-22669069 ACCACAGCAGCCCAGAGAATGGG - Intergenic
1115972372 14:38960296-38960318 ACCTCAGCAGCCACCATAGGAGG + Intergenic
1116428718 14:44820994-44821016 ACCACAGCAGCCCTTAGGAAGGG + Intergenic
1117036412 14:51734270-51734292 AGTAGAGTAGCCCCCAGAGAAGG + Intergenic
1117584155 14:57183016-57183038 ACAACAGCAGCCCTGAGAAATGG + Intergenic
1118353529 14:64991696-64991718 ACCACCTCAGCCCACACAGATGG - Intronic
1119558249 14:75569722-75569744 ACCATAGCAGCCTCCTAAGAGGG + Intergenic
1121257854 14:92544376-92544398 ACCAGAGCAGAAGCCAGAGAAGG - Intronic
1121469930 14:94144812-94144834 CCCTCAGCAGCCCACAGAGAAGG + Intergenic
1121641500 14:95487459-95487481 ACCACAGGAGCTCCCTGAGGAGG + Intergenic
1122236028 14:100331000-100331022 ACCACAGCAGCCCTCTGGCAGGG + Intergenic
1122343985 14:101046673-101046695 GCCCCAGCAGCCCCAAGAAATGG - Intergenic
1122429964 14:101634483-101634505 CCCACAGCAGCCTCCTGGGAAGG - Intergenic
1122437184 14:101708199-101708221 CCTACAGCAGCCCCCAGATAGGG - Intergenic
1122540899 14:102497167-102497189 CGCCCAGCAGCCCCCAGTGATGG - Intronic
1122776419 14:104118834-104118856 CCCTCAGCAGCCCCGTGAGAGGG + Intergenic
1123016303 14:105377236-105377258 CCCAGGGCATCCCCCAGAGACGG - Intronic
1123042852 14:105497481-105497503 CCCACAGCAGCCCCCAGGTGGGG + Intronic
1123495675 15:20823123-20823145 AACACATCAGCTTCCAGAGAAGG + Intergenic
1123552162 15:21392215-21392237 AACACATCAGCTTCCAGAGAAGG + Intergenic
1123588406 15:21829612-21829634 AACACATCAGCTTCCAGAGAAGG + Intergenic
1123898929 15:24856565-24856587 GCCACTGCAGACCCCACAGAAGG - Intronic
1124198552 15:27656526-27656548 AGCACAGGAGCCCACAGAGTTGG + Intergenic
1124371825 15:29108422-29108444 ACCACTGCAGGGCCCAGGGAGGG + Intronic
1127397180 15:58552253-58552275 CTCACAGCAACCCCCAGACAGGG + Intronic
1127707757 15:61564005-61564027 AGCAGAGCAGCCCACAGGGAAGG + Intergenic
1127735887 15:61838927-61838949 ATCAGATCAGCCCCCAGACATGG + Intergenic
1127837400 15:62800808-62800830 CCCACAGCTGACCCCAGTGAGGG + Intronic
1129411061 15:75350555-75350577 CGCACAGCATCCCCCAGAAAGGG - Intronic
1129467383 15:75731647-75731669 ACCTGAGCAGCCCCGAGAGTGGG - Intergenic
1129895849 15:79105315-79105337 ACCACAGCAGCCCCAAGGCAAGG - Intergenic
1130819342 15:87477864-87477886 ACCAGGGCAGCCTCCAGAGGTGG - Intergenic
1130838943 15:87679533-87679555 TCAATAGCAGCCCCCAGAGTGGG + Intergenic
1130941888 15:88517335-88517357 CCCACCTCAGCCCCCAGAGTAGG + Intronic
1131440876 15:92458735-92458757 ACCACAGCTGCCCAGAGACAGGG + Intronic
1131507991 15:93033089-93033111 GCCTCCTCAGCCCCCAGAGAAGG - Intergenic
1132339386 15:101068521-101068543 ATCTCAGCACACCCCAGAGAGGG + Intronic
1202960510 15_KI270727v1_random:119446-119468 AACACATCAGCTTCCAGAGAAGG + Intergenic
1132469017 16:91511-91533 ACCACAGGAGGCCTCTGAGAAGG + Intronic
1132558560 16:583379-583401 ACCACAGCAGCCCCAGGTGGAGG + Exonic
1132758325 16:1496639-1496661 ACCACGGCCGCCCACAGGGAAGG - Intronic
1132867094 16:2098610-2098632 ACCCCAGCAGCACACAGAGAAGG - Intronic
1133460937 16:5985598-5985620 GCCCCAGCAGCCCCCAGGGGAGG + Intergenic
1134524683 16:14934505-14934527 ACCCCAGCAGCACACAGAGAAGG + Intronic
1134548225 16:15126436-15126458 ACCCCAGCAGCACACAGAGAAGG - Intronic
1134712272 16:16332992-16333014 ACCCCAGCAGCACACAGAGAAGG + Intergenic
1134720128 16:16376286-16376308 ACCCCAGCAGCACACAGAGAAGG + Intergenic
1134847107 16:17449335-17449357 AGAACAGCAGCCCCTGGAGAGGG + Intronic
1134947299 16:18335599-18335621 ACCCCAGCAGCACACAGAGAAGG - Intronic
1134954557 16:18375702-18375724 ACCCCAGCAGCACACAGAGAAGG - Intergenic
1136169884 16:28482533-28482555 ACCACAGCAGACCCTGGAAAAGG + Exonic
1136555901 16:31007716-31007738 ACCACACAAGCCCCCTGCGATGG - Intronic
1136615104 16:31393704-31393726 GCCACAGAAGCCACCAGGGAGGG + Intronic
1137583561 16:49650106-49650128 ATTTCAGCAGCCCCCAGAGCTGG - Intronic
1142125580 16:88408757-88408779 ACCCCAGCTGGCCCGAGAGAGGG + Intergenic
1142214579 16:88824350-88824372 ACCACAGCAACCCCCAGTGTGGG - Intronic
1142411768 16:89920659-89920681 CCCACAGCAGCCCCAGGAGAAGG + Exonic
1142756109 17:2017351-2017373 ACCACTGCAGCCCCCAGCGATGG - Intronic
1142839122 17:2613437-2613459 AACACTGCGGGCCCCAGAGAGGG - Intronic
1144429749 17:15180543-15180565 ATCACTGCAGCCCAGAGAGATGG + Intergenic
1144682045 17:17202727-17202749 CGCACAGCAGCCCGCAGGGAGGG + Exonic
1144959011 17:19034417-19034439 CCCACAGCAGCCCTGAGAGCTGG + Intronic
1144976148 17:19140107-19140129 CCCACAGCAGCCCTGAGAGCTGG - Intronic
1147052122 17:37803094-37803116 AACAGAGCAGCTCCCAGAAAGGG - Intergenic
1147585856 17:41653738-41653760 TCAGCAGCAGTCCCCAGAGATGG + Intergenic
1148693348 17:49545406-49545428 ACCCCAGGACCCCCCAGGGAAGG + Intergenic
1148736955 17:49870270-49870292 CCCTCGGCAGCCCCCAGACATGG - Intergenic
1148878776 17:50708869-50708891 ATCCCAGCAGCCCCAAGAGACGG - Intergenic
1150471485 17:65441223-65441245 CCCACTGCAACCCCCAGAAAAGG - Intergenic
1151238567 17:72739665-72739687 ACCTTAGCAGCCCACAGAGAAGG + Intronic
1151289428 17:73138872-73138894 CCAACAGCAGCCCACACAGATGG + Intergenic
1151335962 17:73439874-73439896 ACCACTTCAGAACCCAGAGAGGG - Intronic
1151466236 17:74287263-74287285 ACCAGACCCGCCCCCAGAGCAGG - Intronic
1152223059 17:79079746-79079768 ACCAAGGCGGCCCCCAGCGAGGG - Intronic
1152457144 17:80423042-80423064 GGCGCAGCAGCACCCAGAGAGGG + Intronic
1152816389 17:82410565-82410587 TCAGCAGCAGCCCCCAGAGGCGG + Intronic
1152921670 17:83068972-83068994 ACCACGGCAGCCCCCACGGCTGG - Intergenic
1153799639 18:8658027-8658049 AACACAGCAACCTCCAGAGATGG - Intergenic
1155145232 18:23077948-23077970 ACCCCAGCAGCCACCCAAGAAGG + Intergenic
1156076342 18:33283113-33283135 ACCTCGGCATCCCCCAGAGCAGG + Intronic
1156948137 18:42860231-42860253 AGCCTAGCAGCCACCAGAGAGGG - Intronic
1158390860 18:57043841-57043863 ACCACAGCAGCTTCCAGATGAGG + Intergenic
1160138515 18:76296615-76296637 CACACAGCCGCCGCCAGAGAGGG + Intergenic
1160666975 19:335490-335512 ACCACCCGAGTCCCCAGAGAAGG - Intronic
1160696051 19:484982-485004 CCCACAGCAGCCCCCAGCCCAGG - Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161330515 19:3684710-3684732 ACCACAGACGCACCCAGAGCGGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
1161736672 19:5995833-5995855 CCCCCAGCAGCTCCCAGAGGCGG - Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163146151 19:15380232-15380254 ACCGCCGCCGCCCCCAGAGGAGG - Exonic
1163152268 19:15422518-15422540 GCCCCAGCAGGCCCCACAGAGGG + Exonic
1163862925 19:19751656-19751678 GCCTCAGCAGCACCGAGAGAAGG + Intergenic
1164035258 19:21448826-21448848 AGCAAAGCAGCCACCAGAGATGG - Intronic
1164064698 19:21705989-21706011 AGCAAAGCAACCACCAGAGATGG - Intergenic
1164065358 19:21709874-21709896 AGCAAAGCAGCCACCAGAGATGG + Intergenic
1164169086 19:22708868-22708890 AGCAAAGCAACCACCAGAGATGG - Intergenic
1164222180 19:23204419-23204441 AGCAAAGCAACCACCAGAGATGG + Intergenic
1164512804 19:28911448-28911470 CCCACACCAGCCCCCAGGGATGG + Intergenic
1164581560 19:29438475-29438497 ACCACAGCAGCTGAGAGAGAGGG + Intergenic
1164963626 19:32459727-32459749 ACCCAATCAGCCTCCAGAGATGG - Intronic
1165945777 19:39441380-39441402 AACACAGCAGTTCCCATAGATGG - Intronic
1167516013 19:49923604-49923626 CCCACACCAGGCCCCAGAGCAGG + Intronic
1168666637 19:58209666-58209688 CCCTCAGCAGCCCCCGGAAAGGG + Intronic
1168686464 19:58352247-58352269 CCCCCAGCAGCCCCCAGAGATGG + Intronic
925611022 2:5703345-5703367 ACCACAGGAGCCCTGAGAGGAGG + Intergenic
926118224 2:10226552-10226574 GCCACAGCGGCCCCCATAGCGGG + Intergenic
927189349 2:20506496-20506518 ACCAAAGCAGCCCTAAGTGAAGG - Intergenic
927357107 2:22186581-22186603 CGCACAGGAGCCCACAGAGAGGG - Intergenic
927789673 2:26000569-26000591 AGCAGAGCAGCCCCAAGAGCTGG + Intergenic
927955334 2:27203886-27203908 TACACAGCAGTCCTCAGAGAGGG + Intronic
929080587 2:38118503-38118525 ACCTCAACTGCCCTCAGAGAGGG + Intergenic
929318845 2:40515136-40515158 CCCACAGCATCCTCCAGAGTTGG - Intronic
930947180 2:57089362-57089384 CCCACAGCAGGCCCCGGTGATGG + Intergenic
931160586 2:59685979-59686001 ACCAGAGCAGCCTCCACAGTGGG + Intergenic
934160204 2:89242268-89242290 GCAACTGCAGCGCCCAGAGATGG - Intergenic
934207071 2:89940166-89940188 GCAACTGCAGCGCCCAGAGATGG + Intergenic
934651208 2:96092264-96092286 ACCACCCCACCCCCCAGAGCTGG + Intergenic
935457015 2:103282060-103282082 ACCAAAGCAGTCCAAAGAGACGG + Intergenic
935569270 2:104642030-104642052 ATCACACCAGCCACAAGAGATGG + Intergenic
936043563 2:109168685-109168707 ATCACAACAGACCCAAGAGAAGG - Intronic
937365839 2:121260691-121260713 ACCACAGCACTGCCCAGAGCAGG + Intronic
937495914 2:122419005-122419027 CCCAAAGCATCCCACAGAGATGG - Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
938310524 2:130285897-130285919 ACCTGAGCGGCCCCTAGAGAAGG - Intergenic
938976437 2:136482518-136482540 AAGACACCAGCACCCAGAGAAGG - Intergenic
940148479 2:150573523-150573545 ACCTGAGCAGGCCCCAGAGTGGG + Intergenic
941302141 2:163816094-163816116 CCCACAACAGTCCCCAGAGTGGG + Intergenic
941534171 2:166702886-166702908 CCCACAACAGTCCCCAGAGTGGG + Intergenic
941569591 2:167153568-167153590 CCCACAACAGTCCCCAGAGTGGG + Intronic
941612208 2:167675964-167675986 TCCAAAGCAGCTCCCAGAAATGG + Intergenic
942383811 2:175420769-175420791 GCCACAGCAGCTCCAAGATAAGG - Intergenic
944715216 2:202370979-202371001 CCAACAGCTACCCCCAGAGAGGG - Intergenic
946178923 2:217938340-217938362 AAAACAGGAGACCCCAGAGAGGG + Intronic
947137391 2:226988544-226988566 TCCACACCAGTCCGCAGAGAGGG - Intronic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
947503859 2:230692019-230692041 ACCACAGCCGTCCCTAGACAAGG + Intergenic
947603187 2:231467325-231467347 ACCACAGCAGCAGACAGAGTTGG - Intronic
948015748 2:234689386-234689408 AGCATAGCAGGTCCCAGAGAAGG - Intergenic
948024821 2:234768634-234768656 ACCCCAGCAGCCACCACAGAAGG + Intergenic
948736256 2:240007856-240007878 ACCACAGCACCCTCCACAGCAGG + Intronic
948992879 2:241563632-241563654 CCCACACCAGCTCCCAGACAAGG - Intronic
1169214231 20:3784356-3784378 ACCACAGCAGCAGCCAGGGATGG - Exonic
1169481837 20:5989692-5989714 AAGACAGCAGCCTCCAGGGATGG - Intronic
1171200778 20:23240360-23240382 ACCTCAGCTGCCCCAAGAGCTGG + Intergenic
1171248747 20:23633423-23633445 GCCACAGCAGCCCCTGGTGAGGG - Intronic
1173933701 20:46843339-46843361 AGCACAACAGCATCCAGAGATGG + Intergenic
1173948648 20:46972618-46972640 CCCACAGCAGCCCCAGGAGGTGG + Intronic
1174066169 20:47867529-47867551 ATCAGAGGAGCCCCCGGAGAAGG - Intergenic
1174678785 20:52384186-52384208 GCCACAGCAGCCTCATGAGAAGG - Intergenic
1175290159 20:57870195-57870217 ACCCCTGCACCCCTCAGAGACGG + Intergenic
1175760382 20:61558805-61558827 CACACAGCAGCCTCCTGAGAAGG + Intronic
1176052885 20:63129954-63129976 ACCACAGCAGCACCTGGAGGGGG - Intergenic
1176259199 20:64170361-64170383 GGCCCAGCAGCCCCCAGAGCTGG - Intronic
1176363789 21:6020196-6020218 AGCTCAGCAGCCTCCAGGGAAGG - Intergenic
1176932402 21:14829237-14829259 AACACAGCAGGACCTAGAGAAGG - Intergenic
1177253216 21:18623936-18623958 TCAACAGCAGCCCTCAAAGAAGG - Intergenic
1178327031 21:31654468-31654490 AGCACAGCAGCCCACAGAGAGGG - Intergenic
1178517168 21:33257835-33257857 CCCACAGCATCCACCACAGATGG + Intronic
1178562863 21:33655530-33655552 CCCACCTCAGCCCCCAGAGTGGG + Intronic
1178828057 21:36032600-36032622 CACACAGCAGCCCCCACAGTAGG - Intergenic
1179178401 21:39025240-39025262 ACCCCAGCTGCCCTCAGAGGTGG - Intergenic
1179410514 21:41159478-41159500 ACCACAGTGTCCCCCACAGAAGG - Intergenic
1179759729 21:43518349-43518371 AGCTCAGCAGCCTCCAGGGAAGG + Intergenic
1180056716 21:45362764-45362786 ACTACAGCAGCCCCCAGGAGGGG + Intergenic
1180090906 21:45533482-45533504 CCCACATCAGTCCCCAGGGAGGG - Intronic
1180594859 22:16966485-16966507 AAGACAGCAGCCCCCAGCCAAGG - Intronic
1180968116 22:19801021-19801043 ACGACAGGAGGCCACAGAGAGGG - Intronic
1180987350 22:19912737-19912759 GCCACAGCAGCCTCTAGAGGGGG - Intronic
1181429103 22:22866948-22866970 ATCCCAGCAGCACCCAGAGGGGG + Intronic
1181618403 22:24070957-24070979 ACCACTGCTGTCCGCAGAGAGGG - Exonic
1181860069 22:25811403-25811425 TTCCCAGCAGCCCCCAGTGAGGG + Intronic
1182108263 22:27704587-27704609 ACCACAGCAGCCTCCTGAGCTGG + Intergenic
1182120228 22:27781659-27781681 CCCACAGCAACCCTCTGAGAGGG + Intronic
1182276938 22:29195697-29195719 ATCACAGCTGCCCCCAGAGGAGG - Intergenic
1183591466 22:38781493-38781515 AACACACAAGACCCCAGAGATGG - Intronic
1184158344 22:42683625-42683647 CCCACAGCAGCTCCCAGGGATGG - Intergenic
1185023631 22:48395157-48395179 CCCTCAGCAGCCCCCACATAGGG + Intergenic
1185085369 22:48737967-48737989 CCAACAGCATCCCCCAGGGAAGG - Intronic
1185179747 22:49352524-49352546 GCCACAGCGGCCTCCACAGAGGG + Intergenic
950027913 3:9833341-9833363 ACCACTTCAGCCCCCGGAAAGGG + Intronic
950101580 3:10360111-10360133 CTCTCTGCAGCCCCCAGAGAAGG - Exonic
950308270 3:11933673-11933695 ACCAGAGCAGGAGCCAGAGAGGG + Intergenic
950416608 3:12872582-12872604 ACAGCAGCAGCCCCGAGGGATGG + Intergenic
950435817 3:12979296-12979318 AACACAGCAGGCCTCAGGGATGG - Intronic
950459680 3:13113705-13113727 ACCAGGGCAGCCCCCAGCGTGGG + Intergenic
950641713 3:14352718-14352740 ACATCGGCAGCCCCAAGAGAGGG + Intergenic
953336265 3:42096779-42096801 ACTGCAGCAGCCCCCATTGATGG + Intronic
953405356 3:42657140-42657162 ACCACAGCAGCCTCCCCAAAAGG - Intronic
954300810 3:49699843-49699865 AGCACTGCAGCCCTCAGTGAGGG - Intronic
954391506 3:50270301-50270323 ACCCCAGCACTCCCCAGGGAAGG + Intronic
954430430 3:50467951-50467973 ACCACAGCCGGCCCCAGGGGCGG - Intronic
954644575 3:52123099-52123121 CTCACAGCAGCCCCATGAGATGG - Intronic
954934275 3:54312482-54312504 CCTAGAACAGCCCCCAGAGAGGG - Intronic
956656764 3:71559838-71559860 CCCCCAGCAGCCCCCAGACAAGG - Intronic
958511129 3:95050419-95050441 AGCTGAGCAGCCCCAAGAGATGG + Intergenic
959597842 3:108147122-108147144 ACCACAGGATCCTCCAGAGGCGG + Intergenic
961648094 3:128403360-128403382 TCCAGAGCAGCCCCCAGTGCAGG + Intronic
961838169 3:129682241-129682263 CCCACATCAGCCTCCAGAGTAGG + Intronic
962255797 3:133869356-133869378 TCCACAACTGGCCCCAGAGATGG - Intronic
962346612 3:134623606-134623628 CCCACAGGAGCCTGCAGAGACGG - Intronic
962977873 3:140461755-140461777 ATCCCAGCAGTCCCCTGAGAAGG + Intronic
963675642 3:148307052-148307074 CCCACAACAGTCCCCAGAGTGGG - Intergenic
965851418 3:173030283-173030305 AACACAGCAGCCCACAGAATGGG + Intronic
966087032 3:176080404-176080426 ACGACATAAGGCCCCAGAGAAGG - Intergenic
966622995 3:181985916-181985938 CTCACAGCAGCCCCTAGAGAGGG - Intergenic
967284303 3:187853555-187853577 ACCTCACCAGTCCCCAGAGGAGG + Intergenic
967881756 3:194306441-194306463 CCCACAGCATCCCCCACAGCGGG - Intergenic
968183859 3:196617641-196617663 ATCACAGCAGCGCTGAGAGATGG + Intergenic
968313582 3:197703937-197703959 TTCACAGCAGCCCCGAGAGTTGG - Intronic
968836291 4:2966898-2966920 ACCATAGCAGGGACCAGAGAGGG - Intronic
969321482 4:6415594-6415616 ACCAGAGCAGCCACCAGGAAAGG + Intronic
969589930 4:8115979-8116001 ACCACAGAAGTCCCCACGGATGG + Intronic
970961133 4:21872122-21872144 ATCTCTGCAGCCCTCAGAGAAGG + Intronic
971803696 4:31326979-31327001 ACCACACCAGCAACCAGAGGTGG - Intergenic
973551743 4:52042413-52042435 ACCATACCATACCCCAGAGAAGG + Intergenic
976618249 4:87100223-87100245 AGCCCAGCATCCCACAGAGAGGG - Intronic
976725932 4:88215679-88215701 ACCACAGTAAACCACAGAGATGG + Intronic
981802697 4:148676990-148677012 CCCACAGAAGCTCCCAGAGAGGG - Intergenic
982500966 4:156154064-156154086 ACTATAGCAAGCCCCAGAGAGGG + Intergenic
983045828 4:162985209-162985231 TCCCCAGCAGCCTCCAGAGATGG - Intergenic
985489770 5:172358-172380 GAGACAGCAGCCCCCAGAGATGG - Intronic
985699754 5:1363441-1363463 ACCACAGCAGCCCCTGGGGAGGG - Intergenic
985710679 5:1426956-1426978 ACCACAATAGCCCCCCAAGAAGG + Intronic
985748651 5:1661957-1661979 CCCACAGCAGACCCGAGAGTGGG + Intergenic
990862570 5:60343334-60343356 ACCACAGCAGGGCCCGGAAAAGG + Intronic
994166590 5:96615585-96615607 ACCACGCCAGGCCCCAGGGAAGG + Intronic
995568445 5:113455530-113455552 CTCACAGCAGCCCTCTGAGATGG + Intronic
995975869 5:118034109-118034131 TGCACAGCAGCCCACAGAAAGGG - Intergenic
997230631 5:132239785-132239807 AACACAGCAAGGCCCAGAGAGGG - Intronic
997806086 5:136919607-136919629 CACACAGCGGGCCCCAGAGAAGG + Intergenic
997846887 5:137294651-137294673 AAGACAGCATCCCACAGAGAAGG + Intronic
1002212937 5:177609167-177609189 CCCACAGCAGCCACCAGAGCAGG - Intronic
1002425313 5:179171513-179171535 AGCCCAGAACCCCCCAGAGAAGG + Intronic
1003198608 6:3938199-3938221 CCCACTGCTGCCCCCAGACATGG - Intergenic
1004354635 6:14920423-14920445 AGCACAGCAGACACCAGAGCTGG + Intergenic
1004427017 6:15513535-15513557 CCCACAGCCGGCTCCAGAGATGG - Intronic
1004869192 6:19887322-19887344 ACCACAGTAGCCACCACAGCCGG + Intergenic
1005850054 6:29814396-29814418 ACCACAGCTGCCCTGACAGAGGG + Intergenic
1005870007 6:29967863-29967885 ACCATATCAGCCCCCAGTGATGG - Intergenic
1006146759 6:31963983-31964005 ATCACAGCGGCCCCGGGAGAAGG - Exonic
1007268896 6:40620669-40620691 ACCACAGCAGGAGCCAGACATGG - Intergenic
1007285219 6:40742754-40742776 CACACAGCTGCCCCCAGAAATGG + Intergenic
1008408132 6:51141987-51142009 ACCACCACAGACCCCAGTGAGGG - Intergenic
1008513828 6:52301004-52301026 ACCACAGCAGTCCCTAAAGGTGG + Intergenic
1009889582 6:69664430-69664452 ACCTCAGAAGCCCCATGAGAGGG - Intergenic
1010066322 6:71686394-71686416 AGCACAGGAGCCCACGGAGAAGG - Intergenic
1010275268 6:73961919-73961941 ACACCAGCAACCACCAGAGATGG + Intergenic
1012108083 6:95191305-95191327 AAGACAGCAGGTCCCAGAGAAGG - Intergenic
1013252270 6:108346076-108346098 ACCATAGTAGCCCACAGCGAGGG - Intronic
1016638544 6:146322763-146322785 CCCACAGCAGTCCCCAGTGTGGG + Intronic
1017205099 6:151796395-151796417 ACCTCAGCTGTCTCCAGAGAGGG + Intronic
1017586868 6:155936180-155936202 ACCACACCAGTCCTCAAAGAAGG + Intergenic
1017989431 6:159473246-159473268 ACCACTGCAGCACCAGGAGAGGG - Intergenic
1019150581 6:170003017-170003039 ATCACAGCAGACTCCAGAGCAGG + Intergenic
1019614948 7:1954973-1954995 GCCACAGCAGGGCCCAGTGACGG + Intronic
1019782959 7:2955165-2955187 ACCACAGCGGCTCTGAGAGATGG + Intronic
1024030474 7:45456025-45456047 CCCACAGCAGGCACCAGGGAGGG + Intergenic
1024609768 7:51054569-51054591 CCCACAGCAGTCCCCAGTGCAGG - Intronic
1025158751 7:56634935-56634957 AGCACTGCACCCCCCAGGGATGG + Intergenic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1026973800 7:74484048-74484070 CACTGAGCAGCCCCCAGAGATGG + Intronic
1028454327 7:91021990-91022012 CCCACAGAAGCCCACAAAGAGGG + Intronic
1029515541 7:101020929-101020951 CCCTCACCTGCCCCCAGAGAAGG + Intronic
1032276354 7:130459546-130459568 AGCCCGGCAGCCACCAGAGAGGG - Intergenic
1032458852 7:132094413-132094435 CCCACAGGAGCCCAAAGAGAGGG - Intergenic
1033065115 7:138146405-138146427 AGCACAGGAGCCCACAGAGTTGG - Intergenic
1033278644 7:139990636-139990658 ACCAGAGCGGCCCCGAGAGGGGG - Intronic
1033545639 7:142397672-142397694 ACCAGAGAAGACCCCAGAGCAGG - Intergenic
1034225305 7:149476921-149476943 AACACAGCAGCCTCCACGGAAGG - Exonic
1034328021 7:150255434-150255456 TACACAGCAGTCCCCACAGAGGG - Intronic
1034765195 7:153714014-153714036 TACACAGCAGTCCCCACAGAGGG + Intergenic
1034922954 7:155098852-155098874 ACCACAGCAGCCCCACGGGCTGG + Intergenic
1035356640 7:158279753-158279775 GCCTCAGCAAGCCCCAGAGAGGG + Intronic
1035389151 7:158494238-158494260 GCCACAGCGACGCCCAGAGATGG - Intronic
1035430765 7:158818897-158818919 ACCTCAGCACACCCCACAGAAGG + Intronic
1035632545 8:1119757-1119779 ACCACAGCTGCCTCTAGAGTTGG + Intergenic
1035854388 8:2958653-2958675 AGGAAAGCAGCCCCCAGGGAAGG + Intronic
1035897638 8:3421963-3421985 ACCACAACCGGCCCCACAGATGG + Intronic
1036386265 8:8284561-8284583 ACCTCAGCAGACCCCAGTGCTGG - Intergenic
1037876813 8:22552498-22552520 ACCACAGGAACCTCCAGGGAAGG - Intronic
1037926155 8:22845642-22845664 CCCCCAGCAGGCCACAGAGATGG - Intronic
1038192771 8:25339136-25339158 TCCACTGCAGCCTCCAGACATGG - Intronic
1038543288 8:28406732-28406754 GCCTCAGTAACCCCCAGAGAGGG + Intronic
1039245383 8:35602883-35602905 CCCACAACAGTCCCCAGAGTGGG + Intronic
1039489898 8:37939703-37939725 TCCCTAGAAGCCCCCAGAGAAGG + Intronic
1039902868 8:41765942-41765964 GCCACCCCAACCCCCAGAGAAGG - Intronic
1040290550 8:46121913-46121935 ATCACAGAAGCCCCCAGGGCTGG - Intergenic
1040694821 8:49983682-49983704 CCAACAGAGGCCCCCAGAGAGGG + Intronic
1040877471 8:52168166-52168188 TGCACAGGAGCCCTCAGAGAGGG + Intronic
1044274450 8:90284065-90284087 CCCACAGCAGCATCCAGGGAAGG - Intergenic
1045304845 8:100950709-100950731 GCCACAGCAGCCCGCAGAAGCGG + Intronic
1047646405 8:126874855-126874877 ACTGTAGCAGCCTCCAGAGAGGG - Intergenic
1047752553 8:127892763-127892785 CCCTCAGCAGCCCCCCGAAATGG - Intergenic
1048425519 8:134319656-134319678 CCCACAGCAGCCCAGGGAGAGGG + Intergenic
1049530550 8:143152346-143152368 ACCTCCCCAGCCCCCGGAGAGGG + Intergenic
1050377788 9:4991055-4991077 AGCACAAAAGCACCCAGAGATGG - Intronic
1050478458 9:6064907-6064929 ACCATAGCAGACCCCATAGCAGG - Intergenic
1051742286 9:20263534-20263556 ACCACTGCATCCATCAGAGAAGG + Intergenic
1051983836 9:23057910-23057932 CCCACAGCAGCATCCAGGGATGG - Intergenic
1052220777 9:26018817-26018839 ACCATATCAACCCCCAAAGAAGG + Intergenic
1056752428 9:89362321-89362343 ACCACAGCCACCCCCGGAGAAGG - Intronic
1057255566 9:93544363-93544385 ACCACACCAGCACCCAGACCTGG - Intronic
1057442433 9:95091876-95091898 ACCCCAGCAGCCCCCATGGGAGG + Intergenic
1058256944 9:102778221-102778243 CCCACAGCAGCCTCCAGAGGTGG - Intergenic
1058351332 9:104028250-104028272 ACCAGAGTAGCCCCAAGAGAAGG + Intergenic
1058896940 9:109408682-109408704 AACGCAGATGCCCCCAGAGAGGG + Intronic
1060174898 9:121490469-121490491 ACCACTGATGCCACCAGAGATGG - Intergenic
1060220842 9:121763337-121763359 TCCCCAGCAGCCCCCAAAGGTGG + Intronic
1061745887 9:132740135-132740157 GCCACAGCAGCCCCCTAAGGCGG + Intronic
1062445566 9:136592717-136592739 GTTACAGCAGCCCCCAGACACGG + Intergenic
1185509167 X:650072-650094 ACCCCAACGGCCACCAGAGAAGG - Intronic
1186766138 X:12772350-12772372 TACACAGCAGCCCTGAGAGAGGG - Intergenic
1187172890 X:16869652-16869674 ACCCCAGCAACCCCCGGACAAGG + Exonic
1191618602 X:63192649-63192671 TGCACAGCAGCCCACGGAGAGGG + Intergenic
1191928312 X:66340229-66340251 CCCACAACAGTCCCCAGAGTGGG - Intergenic
1192056279 X:67777107-67777129 CCCCCAGGAGCACCCAGAGAAGG + Intergenic
1192539951 X:71959288-71959310 CCAAAGGCAGCCCCCAGAGAGGG + Intergenic
1193398978 X:81020204-81020226 ACCACATTAGCCCCCAGCAATGG - Intergenic
1194834931 X:98670488-98670510 CCCACAACAGTCCCCAGAGTGGG - Intergenic
1194961293 X:100238688-100238710 ACCATAGCAACCCCCACCGAGGG + Intergenic
1195285173 X:103376735-103376757 AACACAGAGGCCCCCAGGGATGG + Intronic
1196383535 X:115121002-115121024 CCCACAACAGACCCCAGAGTGGG - Intronic
1197032057 X:121828392-121828414 CCCACAACAGTCCCCAGAGTGGG - Intergenic
1198506082 X:137302678-137302700 ACAACAGAAACCCCCAGAAAGGG - Intergenic
1198525524 X:137496604-137496626 CCCACAGAAGCTCCAAGAGAGGG + Intergenic
1199148965 X:144406139-144406161 CCCACAACAGTCCCCAGAGTGGG - Intergenic
1199601800 X:149545438-149545460 ACCACAGCAGGCCCAAGGGAAGG - Exonic
1199648579 X:149934045-149934067 ACCACAGCAGGCCCAAGGGAAGG + Exonic
1200076363 X:153553280-153553302 ACCAGGGCAGCTCACAGAGAAGG - Intronic
1201343135 Y:12955161-12955183 AAAACAGCAGCCCTCAGAAATGG - Intergenic
1201736166 Y:17264353-17264375 CCCACAACAGTCCCCAGAGTGGG - Intergenic