ID: 915014660

View in Genome Browser
Species Human (GRCh38)
Location 1:152721478-152721500
Sequence GACCCAGTTGGTGGTACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915014660_915014666 -3 Left 915014660 1:152721478-152721500 CCTCTTGTACCACCAACTGGGTC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 915014666 1:152721498-152721520 GTCCTGCAATGTTGGAGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 166
915014660_915014667 -2 Left 915014660 1:152721478-152721500 CCTCTTGTACCACCAACTGGGTC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 915014667 1:152721499-152721521 TCCTGCAATGTTGGAGGATGGGG 0: 1
1: 0
2: 1
3: 26
4: 714
915014660_915014669 16 Left 915014660 1:152721478-152721500 CCTCTTGTACCACCAACTGGGTC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 915014669 1:152721517-152721539 TGGGGTGCTAAAGTTCCCTGTGG 0: 1
1: 0
2: 4
3: 7
4: 139
915014660_915014664 -8 Left 915014660 1:152721478-152721500 CCTCTTGTACCACCAACTGGGTC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 915014664 1:152721493-152721515 ACTGGGTCCTGCAATGTTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 266
915014660_915014665 -4 Left 915014660 1:152721478-152721500 CCTCTTGTACCACCAACTGGGTC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 915014665 1:152721497-152721519 GGTCCTGCAATGTTGGAGGATGG 0: 1
1: 0
2: 1
3: 20
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915014660 Original CRISPR GACCCAGTTGGTGGTACAAG AGG (reversed) Intergenic
900191204 1:1353059-1353081 GTCCCACATGGTGGTACAGGTGG + Exonic
902738649 1:18418680-18418702 GGACCAGTTGGTGGTCCAGGTGG + Intergenic
904835990 1:33336725-33336747 GACCCAGCTGCTGGTTCAGGAGG + Intronic
907150748 1:52285099-52285121 GACCAAGTTGGTGGCAGAATTGG + Intronic
909447822 1:75767174-75767196 GACACAGTGGGGGGTGCAAGGGG - Intronic
913499914 1:119462551-119462573 TATACAGTTGGTGGTACAGGAGG + Intergenic
915014660 1:152721478-152721500 GACCCAGTTGGTGGTACAAGAGG - Intergenic
916858855 1:168780978-168781000 GACCCAGTAGGAGGTAAAAATGG + Intergenic
919732420 1:200921750-200921772 GATCCAGTTTCTGGGACAAGTGG - Intergenic
919849479 1:201663032-201663054 CAGCCAGTCTGTGGTACAAGAGG - Intronic
921414558 1:214871163-214871185 TACTCAGTTGGTGGTACAGGTGG - Intergenic
922522613 1:226269562-226269584 GACCACGTTGGTGGTAGTAGTGG - Intronic
922598622 1:226833227-226833249 TACCCAGTTGGAGGACCAAGTGG - Intergenic
1072284789 10:93903961-93903983 GACCCTCTTGATAGTACAAGTGG - Intronic
1073312211 10:102551139-102551161 GAGCCAGTTGTTGGCACATGAGG + Intronic
1074437485 10:113446338-113446360 GACCCACTTGGGGGCACAAATGG - Intergenic
1076884382 10:133255132-133255154 GACCCAGGTGGTGGAGAAAGGGG - Intergenic
1083452558 11:62755577-62755599 GACCCAGGTAGTGTTACTAGAGG + Intergenic
1087118180 11:94545246-94545268 GGCTCAGTTGGTGGTAGTAGCGG - Exonic
1092219302 12:6701729-6701751 GATCCAGGTGGTGGGAGAAGGGG - Intergenic
1092329144 12:7566808-7566830 TAAGCAGTTGGTGGTACAGGAGG - Intergenic
1097399397 12:59110538-59110560 GACCAAGATGGTGCTACAGGAGG + Intergenic
1105595112 13:21830039-21830061 GGCACAGTTGATGGTACAGGAGG + Intergenic
1108356996 13:49637036-49637058 GACCCAGGTGCTGGGACAGGAGG - Intergenic
1112292822 13:98160061-98160083 TACACAGTTGTTGGTACCAGAGG + Intronic
1123497962 15:20849313-20849335 GACCCAGTGGGTCAAACAAGAGG - Intronic
1123555193 15:21422940-21422962 GACCCAGTGGGTCAAACAAGAGG - Intronic
1123591438 15:21860272-21860294 GACCCAGTGGGTCAAACAAGAGG - Intergenic
1128877542 15:71214745-71214767 GACCGAGTTGGAGGTTAAAGGGG + Intronic
1129938966 15:79477437-79477459 GACCTAGTTGGTGGAGGAAGAGG - Intergenic
1202963539 15_KI270727v1_random:150150-150172 GACCCAGTGGGTCAAACAAGAGG - Intergenic
1132975633 16:2709871-2709893 GACCCAGTTTCTGCTCCAAGGGG + Intergenic
1133951374 16:10396771-10396793 GTCCCAGTAGCTGGGACAAGAGG + Intronic
1135102256 16:19616253-19616275 AACCCAGTTGGTTTTCCAAGTGG + Intronic
1135987626 16:27195633-27195655 GCTCCTGCTGGTGGTACAAGGGG - Intergenic
1136147560 16:28324300-28324322 GACCCAGATTCTGGGACAAGGGG + Intergenic
1140632514 16:76871041-76871063 GAGCCTGTTGGGGGTGCAAGGGG + Intergenic
1143611301 17:8019408-8019430 GACCCAGTTTAAGGTAGAAGTGG + Intronic
1144725157 17:17498156-17498178 GAGCCAGTTGAGGGTACATGGGG + Intergenic
1153769042 18:8400793-8400815 ACACCAGTTGGTGGCACAAGGGG - Intronic
1154455960 18:14525734-14525756 GACCCAGTGGGTCAAACAAGAGG - Intronic
1155218761 18:23665882-23665904 GTCCCAGTTGATGGTCCAACAGG + Intergenic
1160863326 19:1246742-1246764 GACCCAGTTGGAGGGAGGAGGGG - Intergenic
1161034434 19:2076649-2076671 GACCCTGCTGATGGGACAAGTGG - Intronic
1161535847 19:4818065-4818087 CAGCCAGCAGGTGGTACAAGCGG + Exonic
1164804898 19:31109126-31109148 GACCCATTTGGCAGTACAAAAGG + Intergenic
1166948718 19:46412666-46412688 GACCCAGTTCCTGGAAGAAGAGG - Exonic
1168136715 19:54356766-54356788 GACCCCGGTGGTGGAAGAAGGGG - Intronic
930194516 2:48495965-48495987 GATTCAGTTGGTGGTATAATTGG + Intronic
933692549 2:85190487-85190509 GAACCAGTTGGTGGTAGATGTGG + Intronic
940006894 2:149016408-149016430 GACCCAGGTGGTGGCAGCAGGGG + Intronic
947013215 2:225589214-225589236 GACCTAGTTGGTGGATAAAGTGG - Intronic
1170169253 20:13393121-13393143 TAAGCAGTTGGTGGTACAGGAGG - Intronic
1172331645 20:34079840-34079862 GACCCTGTTGCTGATAAAAGGGG - Intronic
1172439949 20:34958284-34958306 GACCCAGTTTGTGGTAGGACTGG + Intergenic
1176818202 21:13627609-13627631 GACCCAGTGGGTCAAACAAGAGG + Intronic
1178096655 21:29222758-29222780 GAAGAAGTTGGTGGTACAGGAGG - Intronic
1180609504 22:17085981-17086003 GACCCAGGTGGTGGTAGTCGGGG - Intronic
1181540552 22:23570735-23570757 GACCCAGTTGGTGGCAGGGGCGG + Intergenic
1182532345 22:30969734-30969756 GACCCAGTTGGGGGGGCAGGAGG + Intergenic
1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG + Intronic
1185109103 22:48890855-48890877 GAACCAGATGGAGGAACAAGGGG + Intergenic
952109797 3:30109234-30109256 GACCCAGGTGCAGGTGCAAGAGG + Intergenic
954515722 3:51174974-51174996 GCCCCAGTTGGTTGCTCAAGTGG + Intronic
956749183 3:72332749-72332771 GCACCAGCTGGTGGTTCAAGGGG - Intergenic
957958155 3:87216242-87216264 GACCCACTTGATGTTACAAAAGG - Intergenic
958168935 3:89914716-89914738 GACCCAGGTGCAGGTGCAAGAGG - Intergenic
960993281 3:123325354-123325376 CACCCAGGTGGTTGTAGAAGGGG + Exonic
961798567 3:129427340-129427362 GACCCAGTTAGTGGGGGAAGGGG - Intronic
968261972 3:197332554-197332576 GACTGAGTGGGTGGTCCAAGGGG + Intergenic
970260627 4:14220692-14220714 GACCTAGTTGGGGGTCAAAGAGG + Intergenic
975481456 4:74885218-74885240 GCCCCAGTTGGTGGGTAAAGAGG + Intergenic
986786413 5:11118389-11118411 GACTTAGTGGGTGGTACAAAGGG + Intronic
988572954 5:32390246-32390268 GTCCACGTTGGTGATACAAGGGG - Intronic
992704966 5:79381119-79381141 GACCCTGATGGTGGTACCAGTGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1002571203 5:180140267-180140289 GACCCAGCTGGTGATACGATGGG - Intronic
1004264363 6:14136079-14136101 CACCCAGATAGTGGGACAAGTGG - Exonic
1004647181 6:17573793-17573815 GACCCGGGTGTGGGTACAAGAGG - Intergenic
1008741857 6:54618073-54618095 GTCACAGCTGGTGGGACAAGGGG + Intergenic
1010538625 6:77063430-77063452 GACCCAGGTGGTCGTACTGGTGG + Intergenic
1015665122 6:135619701-135619723 TAAGCAGTTGGTGGTACAGGAGG + Intergenic
1018003020 6:159596629-159596651 GCCCCAGTTGGGGGCACAAGGGG + Intergenic
1018658622 6:166064738-166064760 TAAGCAGTTGGTGGTACAGGAGG - Intergenic
1025934560 7:66024608-66024630 GACCCATTTGGTGTTACATCAGG - Intergenic
1027177287 7:75912703-75912725 GACCCAGTTATTGGTTCAATGGG + Intronic
1033409334 7:141102959-141102981 GATCCAGATGGTGGTTCCAGAGG - Intronic
1034832943 7:154325277-154325299 GAGACACTGGGTGGTACAAGGGG - Intronic
1035259502 7:157652627-157652649 GTCCCAGCAGGTGGAACAAGAGG - Intronic
1051972452 9:22906591-22906613 GATCCAATTTGTGGTTCAAGAGG + Intergenic
1059416321 9:114164665-114164687 GAGCCATTTGGTTGGACAAGAGG - Intronic
1203529157 Un_GL000213v1:121894-121916 GACCCAGTGGGTCAAACAAGAGG - Intergenic
1186351943 X:8749061-8749083 GACACAGTTGGTGTTGTAAGTGG - Intergenic
1186607268 X:11105346-11105368 GATCCAGTTGTTGCCACAAGTGG - Intergenic
1199112651 X:143953775-143953797 TACACAGCTGGTGGTAGAAGTGG - Intergenic