ID: 915016397

View in Genome Browser
Species Human (GRCh38)
Location 1:152737908-152737930
Sequence CCTCCAGTACTGCTTGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915016397_915016399 -10 Left 915016397 1:152737908-152737930 CCTCATACAAGCAGTACTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 915016399 1:152737921-152737943 GTACTGGAGGAAATAAGATGTGG 0: 1
1: 1
2: 0
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915016397 Original CRISPR CCTCCAGTACTGCTTGTATG AGG (reversed) Intronic
906376089 1:45297796-45297818 CCTCCATTACTGCTTTGGTGGGG + Intronic
907626306 1:56033552-56033574 CCTCCAGTCCTGCCTGCATGGGG - Intergenic
909884999 1:80930254-80930276 CCTCCAGGACTGCTTACAAGTGG - Intergenic
911502224 1:98701837-98701859 AATCCAGTTCTGCTTGTATTTGG - Exonic
915016397 1:152737908-152737930 CCTCCAGTACTGCTTGTATGAGG - Intronic
915204938 1:154263118-154263140 CGTCCAGAAATGCTTGTAAGGGG - Intronic
916015818 1:160749122-160749144 CCTCCAGACTTGCTTGTAGGAGG + Intronic
920195893 1:204226994-204227016 CCTCCAGTGCTGGTGGTATGAGG - Intronic
923578901 1:235188415-235188437 CACCCAGTGCTCCTTGTATGAGG - Intronic
1062886297 10:1019009-1019031 TCTTCCGTACTGCTTGTATTAGG + Exonic
1075826994 10:125366157-125366179 CCTCCATTACTGCTTTTTTGTGG - Intergenic
1078756151 11:14212322-14212344 CCTCCATTACTGCTTTAATAGGG + Intronic
1080520893 11:33067076-33067098 CCTGCAGAGCTGCATGTATGTGG + Intronic
1081753369 11:45527844-45527866 CCTCCAGACCTCCTTGGATGAGG + Intergenic
1088237048 11:107736616-107736638 AATCCAGTTCTGCTTGTATTTGG + Intergenic
1090333323 11:125947538-125947560 ACTCCAGAAGTGCTTTTATGTGG + Intergenic
1091631217 12:2162325-2162347 CCATCAGTCCTGCTTGGATGAGG + Intronic
1095318301 12:40793645-40793667 CCTTTAGTACTTCTTTTATGTGG + Intronic
1097131934 12:56817785-56817807 CCTTCAGTTCTGCCTGTGTGAGG + Intergenic
1098602125 12:72344709-72344731 CCTCCACTTCTGCATGTATTAGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102147943 12:110668942-110668964 TCTCCAGGACTCCTGGTATGGGG - Intronic
1109874083 13:68375575-68375597 CCTTCAGTGCTGCTAGTATATGG + Intergenic
1110520795 13:76473638-76473660 CCTCCAGTTCTGCTGGGTTGTGG - Intergenic
1123919189 15:25058581-25058603 CCTCCAGTGCTGGTTGTGTTTGG + Intergenic
1123920968 15:25069509-25069531 CCTCCAGTGCTGGTTGTAGTTGG + Intergenic
1124553190 15:30701325-30701347 CCTTAAGTACTGCCTGTATCAGG - Intronic
1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG + Intronic
1126867626 15:52953416-52953438 CCTCCAGTACTTCATATAAGTGG - Intergenic
1131818928 15:96251826-96251848 CCTCCTGTATTGCCTGTTTGGGG - Intergenic
1139150147 16:64372391-64372413 CCTCCAGTAATGAATATATGTGG - Intergenic
1141369447 16:83473626-83473648 CCTGCATTACAGCTTGTCTGGGG - Intronic
1141446292 16:84060766-84060788 CCTCCAGTACACATCGTATGGGG - Exonic
1142978031 17:3656774-3656796 CGTGCAGTGCTGCCTGTATGAGG + Exonic
1145734356 17:27216639-27216661 CCTACAGTCCTGCTTGGGTGGGG - Intergenic
1150362584 17:64549854-64549876 TCTCCAGTAAGGCTTCTATGGGG + Intronic
1157409048 18:47448602-47448624 CCTTCAGAACTTCTTTTATGAGG + Intergenic
1157782079 18:50448511-50448533 CCCCTAGTGCTGCTTTTATGGGG + Intergenic
1160239580 18:77113445-77113467 CCTCCAGGACTGTGTGTGTGTGG + Intronic
926581323 2:14634462-14634484 CCGCCAGGACAGCCTGTATGAGG + Exonic
929676509 2:43937325-43937347 TCTCCAGTACACTTTGTATGAGG - Intronic
930874137 2:56194512-56194534 CCTCCACTACTGCTTGGAGCTGG - Intronic
931224082 2:60314178-60314200 CCTCAGGTGCTGCTTGTATTGGG + Intergenic
932983421 2:76698126-76698148 CATCCAGTGCTTCTTGCATGGGG + Intergenic
936377555 2:111954965-111954987 CTTCCAGTAATTCATGTATGAGG + Intronic
940799395 2:158116572-158116594 TCTCCAGTAGTGGTTGAATGGGG + Intronic
941868769 2:170361856-170361878 CCTCAAGCCCTGCTTGTCTGGGG - Intronic
942736621 2:179121792-179121814 CTTCCATCACTCCTTGTATGTGG + Exonic
943152373 2:184130702-184130724 CCTCCACTCCTGCTAGTAAGTGG - Intergenic
946405145 2:219488492-219488514 CCTCAAGGACTTCTTGTCTGGGG - Exonic
948978343 2:241478504-241478526 CTTCCTGTACTCCTTGTATCAGG + Intronic
1168940406 20:1706715-1706737 CCTCCAGTCCTGCCTGTCTTGGG + Intergenic
1174510777 20:51050720-51050742 CCTCCAGCACTGATTCCATGGGG - Intergenic
1178797713 21:35760343-35760365 CCTCCAGTACCTCCTGTATTAGG - Intronic
1179227340 21:39465988-39466010 CCTACAGCACTGTTTGTAAGGGG - Intronic
1181330804 22:22089181-22089203 CCTCCAGGACTGATGGAATGAGG + Intergenic
950115081 3:10445567-10445589 CATCCAGTACTGCTGGGCTGTGG + Intronic
950357520 3:12424447-12424469 CTTCCAGGACTGCTGGTGTGGGG - Intronic
952228506 3:31404263-31404285 CCTCCCTTACTGCTTTTTTGAGG - Intergenic
954433703 3:50484865-50484887 CCTCCTGTCCAGCTTGTGTGTGG + Intronic
957525516 3:81374195-81374217 CCTCCAATGATGCTTGGATGAGG + Intergenic
958618835 3:96530635-96530657 CCTCCATAACTGATTTTATGAGG + Intergenic
960942622 3:122944526-122944548 CCTCAATTCCTTCTTGTATGAGG + Intronic
961159247 3:124707896-124707918 CTTCCAGCTGTGCTTGTATGAGG + Intronic
966772224 3:183514378-183514400 GCTCCAGGACTGCTTGGAGGAGG - Intronic
967216113 3:187211996-187212018 CCTGCAGTACTCCTTGCAAGAGG + Intergenic
967389940 3:188945931-188945953 CTGCCAGTACTGCTTCTTTGAGG + Intergenic
976976964 4:91177328-91177350 CCTCCATTACTCATTTTATGAGG - Intronic
988727001 5:33936303-33936325 CCTCTGGGACTGCTTGGATGAGG - Intergenic
993089812 5:83411393-83411415 CCTCCATAACTCCTTTTATGAGG + Intergenic
994261861 5:97669077-97669099 CCTCCAGTTCTCCTTTTCTGAGG - Intergenic
1003177588 6:3764307-3764329 CCTCCACAACTCCTTGAATGAGG - Intergenic
1003241761 6:4351281-4351303 ACTCTAGTACTGCATGTACGTGG + Intergenic
1005355516 6:24979593-24979615 CCTCCAGTTCTGCTTTGCTGGGG + Intronic
1011301140 6:85875425-85875447 CCTCCATAACTGATTTTATGAGG - Intergenic
1013738225 6:113252218-113252240 CCTCCATAACTGATTCTATGAGG + Intergenic
1014000183 6:116356768-116356790 CCTCCCGTGCTGCTTGTCTTTGG + Intronic
1014675585 6:124360281-124360303 CCTCCAGAACTCATTTTATGAGG - Intronic
1014901058 6:126966125-126966147 CCTCCAGTTCTGCATGACTGGGG + Intergenic
1015310404 6:131760882-131760904 CTTCTAGCACTGCTTGTATAGGG + Intergenic
1015941255 6:138454486-138454508 CCCCCAGTAATGACTGTATGGGG - Intronic
1018314452 6:162542977-162542999 CCCCCAGGACTGCTTCTCTGAGG + Intronic
1020278511 7:6638144-6638166 CCCCCAGCTCTGCTTGTGTGGGG + Intronic
1021900771 7:25283001-25283023 ACGCCAGTTCTGCTTTTATGTGG + Intergenic
1035156873 7:156921394-156921416 CCTCGAGTGCTGGTTGTGTGGGG - Intergenic
1037212257 8:16405021-16405043 CATCCAGCACTGGTTGTATTTGG + Intronic
1037285082 8:17290687-17290709 CCTCCCTAACTGATTGTATGAGG - Intronic
1037910109 8:22739235-22739257 CCTCCCGTGCTGCATGTAGGAGG + Intronic
1039300968 8:36208411-36208433 CCTCCAGTACCCCTTCTCTGTGG - Intergenic
1039475765 8:37838735-37838757 CCTCCAGTCCTGCTTTGCTGAGG - Intronic
1045477239 8:102563754-102563776 CCACCAGTACTTCTTCAATGTGG + Intergenic
1049452188 8:142668100-142668122 CCTCAAGTACTGCTGGCCTGCGG - Intronic
1051931882 9:22395669-22395691 CCTCCATTTCAGCTTGTAAGAGG + Intergenic
1055028314 9:71745564-71745586 CCTGCAGGACTGCTTGTATTTGG - Exonic
1055913828 9:81379980-81380002 CCTCCCTTACACCTTGTATGGGG - Intergenic
1059325811 9:113503530-113503552 CCCACAGTCCTGCTTGGATGTGG + Intronic
1060052279 9:120385916-120385938 CCCCGAGAACTGCTTGTAAGTGG - Intergenic
1061630639 9:131870105-131870127 CCTCCAGCTCTGATTGTAGGAGG - Intronic
1191810108 X:65176911-65176933 CCTCCATAACTCATTGTATGAGG + Intergenic
1191959898 X:66689498-66689520 CCTCCATAACTCCTTTTATGAGG - Intergenic
1194426010 X:93739234-93739256 CCCCCACTACTGCATGCATGGGG - Intergenic
1196003871 X:110814743-110814765 CCTCCAGAACTGCTCTTATAAGG - Intergenic
1201921020 Y:19233322-19233344 CCTCCAGCCCTGCTTCTCTGGGG + Intergenic