ID: 915021549

View in Genome Browser
Species Human (GRCh38)
Location 1:152784735-152784757
Sequence CTTCATCTACTGAAAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915021540_915021549 27 Left 915021540 1:152784685-152784707 CCATATTGTTGTACACAAACTTG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG 0: 1
1: 0
2: 0
3: 20
4: 181
915021542_915021549 2 Left 915021542 1:152784710-152784732 CCAGAGAGGAACTCTTGCCCCTT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG 0: 1
1: 0
2: 0
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915021549 Original CRISPR CTTCATCTACTGAAAGTAGA GGG Intronic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
905784671 1:40744837-40744859 CTCAATCTACTGATTGTAGAGGG + Intronic
910070426 1:83207046-83207068 CTTCATCTCCTGCAACTAGAGGG + Intergenic
912672970 1:111648575-111648597 CTCCATCTGCAGGAAGTAGAGGG + Intronic
912675675 1:111678983-111679005 CTGCATTTACTGATAGTATATGG - Intronic
913140644 1:115938142-115938164 TTTCATCTCCTCAAAGGAGAGGG - Intergenic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
916176145 1:162040618-162040640 CTTCCTCTACTGCTAGTAAATGG - Intergenic
918685831 1:187413949-187413971 TTTCATTTACTGAAAGCAGGGGG + Intergenic
921529665 1:216265846-216265868 GTTGATCTCATGAAAGTAGAAGG + Intronic
922546464 1:226461166-226461188 CTACATCCCCTGAAGGTAGAAGG + Intergenic
924725683 1:246668507-246668529 CTTCAGCTACTGTCAGCAGATGG - Exonic
1063519228 10:6725890-6725912 ATTCATAGACAGAAAGTAGAAGG - Intergenic
1064807872 10:19157746-19157768 CTTCATTTTCTGAAATTATATGG + Intronic
1064849886 10:19698777-19698799 CTTAATGTTTTGAAAGTAGATGG + Intronic
1065284360 10:24173275-24173297 CTTGTTTTACTGAAACTAGATGG - Intronic
1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG + Intergenic
1068972152 10:62970454-62970476 AGTCTTCTACTGAAAGTAGATGG + Intergenic
1071739048 10:88336043-88336065 CTCCATCTACTGAATGAACACGG + Intronic
1072034503 10:91551999-91552021 CTGCATCAACTGCCAGTAGATGG - Intergenic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1079244397 11:18742395-18742417 CTTCACCTACTCAGAGTGGATGG - Exonic
1080015212 11:27499054-27499076 CTTGATCTACTGAAATAATAAGG - Intronic
1082908785 11:58345542-58345564 CTTCATCTACATAAAGAAGGTGG + Intergenic
1084767145 11:71319877-71319899 CTCCTTCTCCTGAAAGCAGAAGG - Intergenic
1085943184 11:81230707-81230729 CTCCTTCTACAGAAAGAAGAAGG + Intergenic
1086542686 11:87931869-87931891 CTCCATTTACTGTAAGCAGAAGG + Intergenic
1086924816 11:92628835-92628857 CTGGATCTTCTGAAAGAAGAAGG + Intronic
1088385666 11:109252448-109252470 GTTCATCTCATTAAAGTAGAGGG - Intergenic
1090842090 11:130499123-130499145 CTTCCTCTCCTGGAAGCAGAAGG + Intergenic
1091124989 11:133086497-133086519 TTTCATCTACAGGAAGAAGATGG - Intronic
1093974280 12:25403748-25403770 ATGCATCAACTGAAAGTGGAAGG + Intergenic
1095818894 12:46455320-46455342 CTTCATCCACTGATGGGAGATGG + Intergenic
1095930294 12:47618916-47618938 TTTCTTCAACTGAAAGTTGAAGG - Intergenic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1098213423 12:68190168-68190190 CCTCATCTACTGAAAAAACATGG - Intergenic
1098362715 12:69670570-69670592 CGAGATCTCCTGAAAGTAGAAGG + Intronic
1110569615 13:76990291-76990313 TTCCATCTACTGTTAGTAGAGGG - Intergenic
1110720482 13:78755614-78755636 CCACATATACTGAAAGTAGTAGG - Intergenic
1112032959 13:95474141-95474163 CTTGTTTTACTGAAACTAGACGG + Intronic
1112217398 13:97447391-97447413 CTTCATCAACAGAAATTAGATGG - Intronic
1112966644 13:105204773-105204795 TTTCAGCTGCTGTAAGTAGATGG - Intergenic
1113161348 13:107384982-107385004 CTCCATCTACAGAAAGTGGGTGG + Intronic
1113419364 13:110158426-110158448 GTTCATCTAATGAAAGGAGTTGG + Intronic
1114004942 14:18302231-18302253 CTTCTTCTATGTAAAGTAGATGG + Intergenic
1114650563 14:24281879-24281901 CTTCCTCTACCCAAAGTAGAAGG + Intergenic
1114712184 14:24789734-24789756 CTCCATCTCCTGTAATTAGATGG - Intergenic
1114799026 14:25750707-25750729 CTTCTTTCACTCAAAGTAGAAGG - Intergenic
1121500947 14:94436961-94436983 CTTAATTTCCTGTAAGTAGACGG - Intergenic
1131191558 15:90320722-90320744 CTTCCTCTAGGGAAAGTAAAAGG - Intergenic
1132306891 15:100821778-100821800 CTTCATAGACAGAAAGTAGTTGG + Intergenic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1133015644 16:2938248-2938270 CTTCCTCTACAGGAAGGAGAAGG + Exonic
1135505766 16:23034763-23034785 CTTGATCTAGTGGAAGTACATGG + Intergenic
1135730594 16:24891823-24891845 CTTCTTCTAATGGGAGTAGACGG + Intronic
1135862389 16:26068574-26068596 ATTCACCTACTGAATGGAGAGGG - Intronic
1137516068 16:49145630-49145652 CTTCCTCTTCTGAAAAAAGAAGG - Intergenic
1145710349 17:26965622-26965644 TTTCTTCCACTGAAAGTAGCTGG + Intergenic
1146828458 17:36045655-36045677 TTTCAGCTACTGAAGGTAGAGGG - Intergenic
1149086003 17:52716894-52716916 AGTCATCTTCTGAAAGTGGAGGG - Intergenic
1151015894 17:70552342-70552364 CTTAATTTAATGAAAGTAGAAGG + Intergenic
1153099323 18:1447960-1447982 CTTCATTTACTGACTGTAGTTGG + Intergenic
1154295747 18:13145758-13145780 CTGCATCTACTCATAGCAGAAGG + Intergenic
1157030768 18:43905010-43905032 CTATATCTATTGAAAGAAGAGGG + Intergenic
1157779161 18:50421806-50421828 ATTTTTCTACTGAGAGTAGAGGG + Intergenic
1157992753 18:52517132-52517154 CTTCCTCTATTGAAAGTCGGAGG - Intronic
1158239391 18:55360064-55360086 TTTCTTCTACTGAAAGAATACGG - Intronic
1162002265 19:7753027-7753049 CTTCATCAACTAAGAGTAGAAGG + Intergenic
1164814075 19:31180960-31180982 CTGCATATACTGAAATTAGCAGG - Intergenic
1166252986 19:41584333-41584355 TGTCATCTGCTGAAAGAAGAAGG - Exonic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1168257548 19:55174991-55175013 CTTCTCCTGCTGAAAGGAGAGGG + Exonic
925105168 2:1284547-1284569 CTCCATCAAAGGAAAGTAGATGG - Intronic
925491215 2:4395495-4395517 TTTCATGTGCTGAAAGGAGAGGG - Intergenic
925887152 2:8402691-8402713 TATCATCTACTTAGAGTAGATGG + Intergenic
926640910 2:15235931-15235953 CTTCATTTAATCAAAGTTGAAGG - Intronic
927386376 2:22538981-22539003 CTTCATCTAGTGATAGCAAATGG + Intergenic
927746648 2:25628251-25628273 CTTGTTCAACTGATAGTAGATGG + Exonic
929279005 2:40057762-40057784 CAGCATCTAGTGAAAGCAGAGGG + Intergenic
930987044 2:57602596-57602618 CTTTATTTACAAAAAGTAGATGG - Intergenic
933569628 2:83994244-83994266 CTTCATCTTCTGAACATTGAAGG - Intergenic
935228926 2:101079204-101079226 CTTCATCTACTAAAAATGAAAGG + Intronic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
941302815 2:163825427-163825449 CTTCCTCTAGTGAAGGTGGAAGG + Intergenic
943019718 2:182557876-182557898 CATCAACTACTGAAAGTAGCTGG + Intergenic
944534748 2:200697556-200697578 CTTCATCTCAAGAAAATAGAAGG + Intergenic
945677483 2:212873118-212873140 CTTGATCAACTGAAAATTGAAGG + Intergenic
945830656 2:214780666-214780688 CTTGAACTACTTAATGTAGAAGG + Exonic
947185004 2:227446764-227446786 CTTCATTTACTGAAATTAACTGG - Intergenic
1169480994 20:5980565-5980587 CTTCATTAACTAGAAGTAGAAGG + Intronic
1169720582 20:8672029-8672051 CATCATCTAGTGATAGAAGAAGG - Intronic
1172001086 20:31777628-31777650 CTTCATCTCCTGTAAGTTGATGG + Exonic
1172987556 20:39004731-39004753 CCTCATCTAATGAAAGGAAAAGG - Intronic
1173013451 20:39203519-39203541 CTTCCTTTACTGACAATAGAAGG + Intergenic
1176920006 21:14677263-14677285 ATTCATCAACTGATAGTATAAGG - Intergenic
1177015890 21:15786524-15786546 CTGTATCTACTGAAATTATATGG - Intronic
1178082824 21:29082563-29082585 CTTGCTCTCATGAAAGTAGAGGG + Intronic
1180429454 22:15233021-15233043 CTTCTTCTATGTAAAGTAGATGG + Intergenic
1181533660 22:23531009-23531031 CTTCTTGTACTGAAAGTATCAGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1185196013 22:49469974-49469996 CTTCAACCACTGAAAATAGCCGG - Intronic
950444846 3:13031040-13031062 GATCATCTGCTGTAAGTAGAAGG + Intronic
951417704 3:22445280-22445302 CTTCATCTACTGCAAACTGAAGG - Intergenic
952129295 3:30341543-30341565 CTTTACCTTATGAAAGTAGATGG - Intergenic
953249136 3:41227437-41227459 CTTTAACTACTGAAAATAAATGG + Intronic
955672599 3:61417773-61417795 ATTTATCTACTGGAAGTAGCGGG + Intergenic
957552961 3:81730670-81730692 TTTCCTTTACTGAAACTAGAAGG - Intronic
958229321 3:90877153-90877175 CTTCACCTACTGTGAGTTGAAGG - Intergenic
959394723 3:105823177-105823199 CTGCTTCTACTGAAAATAGATGG + Intronic
960059685 3:113308263-113308285 CTTCATCTATGGAAAGAGGAGGG + Exonic
963490574 3:145995087-145995109 ATGCAGCTACTGTAAGTAGAAGG + Intergenic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966516639 3:180828255-180828277 CTTCCTCTACAGGAAGGAGAAGG - Intronic
972008218 4:34139101-34139123 ATTCATCTTCTGCAACTAGAAGG - Intergenic
972980686 4:44696987-44697009 CTGCCTCTACTGAATGTGGATGG - Intronic
973650763 4:52995171-52995193 CTTCTTTTACTGCAACTAGATGG + Intronic
975482595 4:74898094-74898116 CTTCATCAAATGAAATCAGAGGG - Intergenic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
976632478 4:87253147-87253169 CTTTTTCTATTGAAAGAAGAGGG + Intergenic
977541921 4:98328519-98328541 CTTTATAAACTGAAACTAGATGG - Intronic
978843551 4:113245111-113245133 CTTCTTCATCTGTAAGTAGAAGG + Intronic
979135589 4:117108219-117108241 TTACATCTATTGAAAGTGGATGG - Intergenic
982584251 4:157217559-157217581 CATCTTCTGCTGAAAGTAGGAGG + Intronic
982965874 4:161906893-161906915 CTACATCTACTGGAAGCAGCAGG - Intronic
988429414 5:31101989-31102011 TATCATTTACTGAAAGTTGAGGG + Intergenic
989440073 5:41460391-41460413 CCTCATCTTCTGTAAGTATATGG + Intronic
991197848 5:63957246-63957268 GTTCATCAATTAAAAGTAGAGGG - Intergenic
992884826 5:81148145-81148167 CTTCCTCTTCTGACAGTTGAAGG + Intronic
993599902 5:89909048-89909070 CTTCAAGTACTGACAGAAGATGG + Intergenic
994181554 5:96772297-96772319 CTTAATCTTCAGAAAGGAGAGGG + Intronic
994932883 5:106211983-106212005 CTCTTTCTACTGGAAGTAGAAGG - Intergenic
996080600 5:119254665-119254687 CTTCATCTTCCCAAAGTAGTGGG - Intergenic
997501648 5:134379724-134379746 CTTCATGTACTTAAACTAAACGG + Intronic
998662962 5:144261331-144261353 CTAGATTTACTGAAAGTAGGGGG + Intronic
999635487 5:153617643-153617665 CCTTATCCACTGAAAGTAGGTGG - Intronic
999916239 5:156265165-156265187 CTTCATCTATTGTAATTAGTGGG + Intronic
1000944827 5:167408219-167408241 TTTCAACTCCTAAAAGTAGAAGG + Intronic
1002656453 5:180752274-180752296 CATACTCTACTAAAAGTAGATGG + Intergenic
1003015009 6:2461438-2461460 CTTCTTCTACTGAAAAAAGTAGG - Intergenic
1003039211 6:2671343-2671365 CTTCTTCTAGGGAAAGCAGAAGG + Exonic
1003395831 6:5751269-5751291 CCTGATCAACTAAAAGTAGATGG - Intronic
1004081236 6:12395482-12395504 CTTCAGCAACAGAGAGTAGAAGG + Intergenic
1004082242 6:12406252-12406274 CTTCAGTTACTGAGAGTAGTTGG + Intergenic
1006957896 6:37892540-37892562 CTTTTTCTAGTGAAGGTAGAAGG - Intronic
1009930060 6:70166294-70166316 CTTCATTCACAGAAAGGAGAAGG + Intronic
1015158021 6:130119561-130119583 CTTATTCCACAGAAAGTAGAAGG - Intronic
1015592724 6:134837782-134837804 CTTCATTTAAGGAAAGAAGAAGG - Intergenic
1016726179 6:147371124-147371146 CTACATCTATTCATAGTAGATGG - Intronic
1017058170 6:150456380-150456402 GTTCATCTACTGAAAAGGGAAGG - Intergenic
1017848214 6:158278163-158278185 CTTCATCTAATGCAAACAGAGGG - Intronic
1020458770 7:8404493-8404515 ATTCATAGACAGAAAGTAGAAGG + Intergenic
1020811772 7:12857201-12857223 ATTCATCTAAAGAAAGGAGAAGG - Intergenic
1021237147 7:18156058-18156080 CTTCTGCTACTTAAAGTTGAAGG + Intronic
1021401806 7:20218353-20218375 ATTCATCTAATGTAAGTAGATGG + Intergenic
1027288142 7:76671906-76671928 CTTCATCTCCTGCAACTAGAGGG + Intergenic
1028659236 7:93249722-93249744 CTTCATATACTGTAAGCTGAGGG - Intronic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1030817145 7:114052330-114052352 ATTCATCTACTGAAACTTAATGG + Intronic
1031837698 7:126698234-126698256 CTTCTTCTACAGTAAGTGGAAGG + Intronic
1032152610 7:129442946-129442968 CTTCATCTTCTGTAAGATGAGGG + Intronic
1033352903 7:140576739-140576761 CTTCCTCTACTGAAAGTTTATGG - Intronic
1033972957 7:147066108-147066130 CTTGATGTACAGAAACTAGAAGG + Intronic
1036724124 8:11203969-11203991 CTTCTTCCAAAGAAAGTAGAAGG - Intergenic
1038091846 8:24263064-24263086 TTTCAGCTGCTGTAAGTAGATGG + Intergenic
1038902899 8:31864113-31864135 CTTCCTCAACTGTAAGTTGAGGG - Intronic
1039256346 8:35723099-35723121 CTTCATCCTCTGAAAAGAGACGG - Intronic
1041871210 8:62636478-62636500 TTTCATCTTTTGAAAGTACAAGG - Intronic
1042285276 8:67103114-67103136 TTTCATCTGCTGAAAATAAAAGG + Exonic
1044155986 8:88847934-88847956 CTGCATCTACTGAGACCAGATGG - Intergenic
1048192469 8:132302309-132302331 CCTCTTCTACTGAAAGAAAAAGG + Intronic
1048229982 8:132629203-132629225 TTTCATCAACTGAGAATAGAAGG + Intronic
1048369414 8:133764653-133764675 CTACATCTACTGTAAGTAACTGG + Intergenic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1048758270 8:137763368-137763390 CATCATCTACTGCAAGAAGTTGG + Intergenic
1050861449 9:10437856-10437878 CCTCATCTACTGACACTATATGG - Intronic
1051359878 9:16272610-16272632 CTTCATTAACTGAAAGTGGGTGG + Intronic
1051966699 9:22836574-22836596 TTTCGTCTCCTGAAAGCAGATGG + Intergenic
1052007844 9:23371850-23371872 GTTCATCAAGTGAAAGTAAAAGG + Intergenic
1052323624 9:27194205-27194227 CTCCATTTACTAAAAGTAGAAGG + Intronic
1053710191 9:40799364-40799386 CTTCTTCTATGTAAAGTAGATGG - Intergenic
1054420095 9:64920159-64920181 CTTCTTCTATGTAAAGTAGATGG - Intergenic
1055029344 9:71757675-71757697 GTTCTTCTCCTGAAAGTAGGAGG - Intronic
1055401068 9:75924670-75924692 TTGCATCTGCTCAAAGTAGATGG + Intronic
1055844272 9:80542463-80542485 CTTTCTCTACTGAAATAAGAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057507359 9:95646533-95646555 CTTGAGTTACTGAAAGTTGAAGG + Intergenic
1058780965 9:108334649-108334671 CTTCATTTACTGTAAGAACAAGG + Intergenic
1061246810 9:129404832-129404854 CTTCCTCTACTGAAAGTGTCAGG - Intergenic
1187027207 X:15448005-15448027 CTTCATTCACTGGAAGGAGAGGG + Intronic
1188242078 X:27805433-27805455 TTTCATCTAATGAAATCAGAAGG + Intergenic
1188433525 X:30134493-30134515 CTTCATTTACCCAAAGTAAATGG - Intergenic
1190605988 X:52143401-52143423 CTGCTTCTACTGAAGGTAGAAGG + Intergenic
1192170178 X:68849513-68849535 CTTCATCTGTTGAATGTAAATGG + Intergenic
1192833591 X:74776171-74776193 CTTCATTTACTTAAGGTACATGG - Intronic
1194184538 X:90757899-90757921 CTTCAGCTTCTGAATTTAGAGGG - Intergenic
1194711728 X:97243833-97243855 CTTCCACAACTGAAAGTACAGGG - Intronic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1194941976 X:100021506-100021528 TTTCATATACTGAAAGTTAAAGG + Intergenic
1195084597 X:101402295-101402317 CTTCATGTACTTAAACAAGAAGG - Intronic
1198578580 X:138037447-138037469 CTTCATCTGTGGAAAGAAGAGGG + Intergenic
1200531132 Y:4339842-4339864 CTTCAACTTCTGAATTTAGAGGG - Intergenic
1202029500 Y:20557011-20557033 TTTCTTCTAATGAAAGAAGAGGG - Intergenic