ID: 915021723

View in Genome Browser
Species Human (GRCh38)
Location 1:152786147-152786169
Sequence CAGGACCCACGTGGGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915021713_915021723 28 Left 915021713 1:152786096-152786118 CCTCAGCCTGGGGAGGGAGGCAG 0: 1
1: 0
2: 13
3: 127
4: 909
Right 915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 189
915021715_915021723 22 Left 915021715 1:152786102-152786124 CCTGGGGAGGGAGGCAGGTGAGG 0: 1
1: 1
2: 20
3: 126
4: 958
Right 915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 189
915021712_915021723 29 Left 915021712 1:152786095-152786117 CCCTCAGCCTGGGGAGGGAGGCA 0: 1
1: 1
2: 5
3: 54
4: 490
Right 915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915021723 Original CRISPR CAGGACCCACGTGGGTATCA GGG Intronic
900354396 1:2253280-2253302 GAGCACCCAGGTTGGTATCATGG + Intronic
904285116 1:29449063-29449085 CAGGACCCACGTGGCAGACACGG + Intergenic
904420217 1:30386318-30386340 CAGGACCCACGTGGCAGACACGG - Intergenic
905740301 1:40364540-40364562 CAGGACCAACCTGGGCAACATGG + Intronic
912350199 1:109005199-109005221 CAAGACCAACCTGGGTAACATGG + Intronic
913530713 1:119732486-119732508 CAGGACACACGTGCCTGTCAGGG - Intronic
915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG + Intronic
915372088 1:155359776-155359798 CAAGACCCGCCTGGGTAACATGG - Intronic
916266147 1:162891644-162891666 GGGGACCCAAGTGGGTTTCAGGG + Intergenic
920179633 1:204124539-204124561 ATGGACCCACCTGGGGATCAAGG + Intronic
921203011 1:212824856-212824878 CAAGACCAGCGTGGGTAACATGG - Intergenic
921278259 1:213540549-213540571 CAAGACCCACGTCGGCAACATGG - Intergenic
924679755 1:246220008-246220030 CAAGTCCCACGAGGGTGTCAGGG + Intronic
1063931682 10:11034940-11034962 CAGCACCCACTTGAGTACCAAGG - Intronic
1064125483 10:12656288-12656310 CAGGACCAGCCTGGGTAACATGG + Intronic
1064579723 10:16781784-16781806 CAAGACCAACCTGGGTAACACGG + Intronic
1065598147 10:27337834-27337856 CAAGACCAACCTGGGTAACACGG - Intergenic
1065653607 10:27921964-27921986 CGAGACCCACGTGGGCAACATGG + Intronic
1070271132 10:74956120-74956142 CAGGACCAACCTGGGCAACACGG - Intronic
1071854178 10:89606722-89606744 CAAGACCCACCTGGGCAACATGG - Intronic
1072337618 10:94412928-94412950 CAGGATCTACTTGGGTCTCAAGG - Intronic
1074079400 10:110155919-110155941 CAGGTCCCAGCTGGGCATCAGGG + Intergenic
1074474355 10:113755706-113755728 CAGAACCCAGGTGGGGATAATGG + Intronic
1076303167 10:129443197-129443219 CAGGGCCCTTGTGGGTGTCACGG - Intergenic
1076903351 10:133350574-133350596 CAAGGCCCAGGTGAGTATCAAGG - Intronic
1077289650 11:1783031-1783053 CAAGTCCCACGTGGTTTTCAAGG - Intergenic
1080625273 11:34023557-34023579 CAAGACCAACCTGGGTAACATGG - Intergenic
1080808835 11:35682279-35682301 TAGGTCCCACATGTGTATCATGG + Intronic
1082572357 11:54759263-54759285 AAGGACCCACGTGAATATCAGGG + Intergenic
1082573099 11:54766153-54766175 AAGGACCCACGTGAATATCAGGG + Intergenic
1083909310 11:65696741-65696763 CAGGACCCGCCTGGGCAACATGG - Intergenic
1084132193 11:67144764-67144786 CAAGACCAACCTGGGTAACATGG - Intronic
1085465622 11:76721547-76721569 CAGGACCCAAGTGGGGAAGACGG - Intergenic
1088495395 11:110426907-110426929 CAGGTCCCACGTTGCTATGAAGG - Intergenic
1090764666 11:129866097-129866119 CAGTACCCACCAGGGTCTCAAGG + Intronic
1091113686 11:132994453-132994475 CAGGCGCCTCGTGGGTACCAGGG + Intronic
1093436319 12:19139010-19139032 CAGGAGCAAAGTGGGAATCAAGG + Intronic
1093743360 12:22713018-22713040 CAAGACCAACCTGGCTATCATGG - Intergenic
1095944541 12:47746522-47746544 CAGGAGCCCCGTGGGCCTCAGGG + Intronic
1097300439 12:58012857-58012879 CAGGACCCACCTGGGCAACATGG - Intergenic
1098291663 12:68962459-68962481 TAGGACCCACGTGGGGAAGAGGG - Intronic
1101325666 12:103713406-103713428 CAGGACACACCTGGGGATGAAGG - Intronic
1101918930 12:108916945-108916967 CAAGACCAACCTGGGTAACATGG - Intronic
1104888302 12:132125000-132125022 CAGGAGCCACGTGGTTCTAATGG - Intronic
1104902770 12:132198125-132198147 CAGGGCCCACGTGGGGATGCGGG + Intronic
1105370527 13:19798110-19798132 CAAGACCCACCTGGGCAACATGG - Intergenic
1110745559 13:79049396-79049418 CATGGCCCACGTGGGTGTAATGG + Intergenic
1115852364 14:37598465-37598487 CAGGCCCCACGGGTGTAGCAAGG - Intronic
1118445442 14:65846993-65847015 CAGAACCCACATGGGAATTATGG + Intergenic
1120808336 14:88776678-88776700 CAAGACCAACGTGCGTAACATGG + Intronic
1122856826 14:104563976-104563998 AAGGACCCACGTGGGTGTCTGGG - Intronic
1126022766 15:44418631-44418653 CAAGACCAACTTGGGCATCATGG + Intergenic
1126085627 15:45008830-45008852 CAGGACCAACCTGGGCAACATGG + Intergenic
1126584461 15:50269369-50269391 CAAGACCAACTTGGGTAACATGG - Intergenic
1126634987 15:50771452-50771474 CAAGACCAACCTGGGTAACATGG - Intergenic
1127666070 15:61148250-61148272 CAGGAGGTAGGTGGGTATCAGGG + Intronic
1127939195 15:63676554-63676576 CAAGACCAACCTGGGTAACATGG + Intronic
1130446791 15:84009739-84009761 GTGGACCCACGTGAGTCTCATGG + Intronic
1131276418 15:90985429-90985451 CAAGACCCACCTGGCTAACATGG - Intronic
1134588121 16:15429628-15429650 CAAGACCCACCTGGGCAACATGG + Intronic
1136057718 16:27702805-27702827 CAGGCCCCAGGTGGAAATCAGGG + Intronic
1137650918 16:50119542-50119564 CAAGACCCACCTGGGCAACATGG + Intergenic
1138448431 16:57078904-57078926 CAGGACCTGGGTAGGTATCAAGG - Intronic
1139764539 16:69216014-69216036 CAGGACCAGCCTGGGTAACATGG - Intronic
1143920451 17:10327344-10327366 CAAGACCAGCCTGGGTATCATGG - Intronic
1147710796 17:42462811-42462833 CAAGACCAACCTGGGTAACATGG - Intronic
1148341357 17:46875345-46875367 CAATACCCACGTGGGCATCAAGG + Exonic
1149293720 17:55241638-55241660 CAAGACCCACTTGGGCAACATGG - Intergenic
1152396314 17:80035782-80035804 CGGGACCCGGGTGGGTATCGGGG - Exonic
1153266860 18:3279756-3279778 CCGGACCCATGTGAGGATCAGGG + Intergenic
1156112255 18:33743001-33743023 CAGGACCCTCGCAGATATCAAGG + Exonic
1159013652 18:63083157-63083179 TAGGACCCAGTTAGGTATCAAGG - Intergenic
1162917760 19:13883381-13883403 CAGGACCTTCGTGGGGATCCAGG - Intronic
1163360649 19:16844041-16844063 CAAGACCCACCTGGGCAACATGG - Intronic
1163399919 19:17086000-17086022 CAGAACCCACCTGTGTCTCATGG + Intronic
1163433595 19:17282420-17282442 TAGGACCAAAGTGGGGATCAAGG + Intronic
925178378 2:1800507-1800529 CAGGCCCCCCGTGAGTACCAAGG - Intronic
925566235 2:5257460-5257482 CAGGAACCATGTAGGAATCAAGG + Intergenic
926046386 2:9712544-9712566 AAACACCCACGTGGGCATCAGGG - Intergenic
926144153 2:10386621-10386643 GAGGACTCAGGTGGGTGTCAGGG + Intronic
927413955 2:22857115-22857137 CAGGAGCCTTGTGGGGATCATGG - Intergenic
928527292 2:32153874-32153896 CAGGACCAACCTGGCCATCATGG + Intronic
928869579 2:35961088-35961110 CAAGTCCCACGAGGGGATCAGGG - Intergenic
929532705 2:42762749-42762771 CAGGACTCAGGTGGGTGGCAGGG - Exonic
930060690 2:47286013-47286035 CAAGACCAACGTGGGCAACATGG + Intergenic
930068989 2:47350463-47350485 CAAGACCAACCTGGGTAACATGG - Intronic
931765654 2:65453795-65453817 CAGGACCAACCTGGGTAACATGG + Intergenic
935501352 2:103843859-103843881 CAGGACCAGCCTGGGTAACATGG + Intergenic
937894571 2:126968968-126968990 CAGGACCATCGTGGGCACCAAGG + Intergenic
938308547 2:130270016-130270038 CAGCACCCATGTGGGGAGCATGG + Intergenic
941291330 2:163679289-163679311 CAAGACCATCGTGGGTAACATGG + Intronic
941561988 2:167058285-167058307 CAAGACCCACCTGGGGAACATGG - Intronic
945036300 2:205706811-205706833 CAAGAGCCACGTGTGTATAAAGG - Intronic
947081288 2:226399940-226399962 CAGGACCCACGTGGCAGCCATGG - Intergenic
947635721 2:231680028-231680050 CAGGAGCCACGTGGGAAGGAAGG + Intergenic
947767600 2:232647544-232647566 CAGGAGCCCTGTGGATATCAGGG - Intronic
947871713 2:233442256-233442278 AAGGACCCACATGGGGAGCAGGG + Intronic
1170101759 20:12708784-12708806 CAGGAACCTGGTGGGTCTCATGG + Intergenic
1170204446 20:13783618-13783640 CAGGACCAGCCTGGGTAACATGG + Intronic
1171520248 20:25770326-25770348 CAGGCCCCAGGTGGACATCAGGG + Intronic
1171556671 20:26086167-26086189 CAGGCCCCAGGTGGACATCAGGG - Intergenic
1172307219 20:33889232-33889254 CAGGAGCCAAGAGGGCATCATGG - Intergenic
1172762648 20:37333112-37333134 CAGGCCCCACCTGAGTACCAGGG + Intergenic
1173748048 20:45453112-45453134 CAGGACCCATGTGGAAATGAAGG - Intergenic
1174096172 20:48091335-48091357 CAGGACCAGCCTGGGTAACATGG + Intergenic
1174861045 20:54091154-54091176 CAAGACCAACGTGGGCAACATGG + Intergenic
1176032773 20:63021705-63021727 CAGGGCCCACGTGGACATCAGGG - Intergenic
1176654383 21:9576613-9576635 CAGGCCCCAGGTGGACATCAGGG + Intergenic
1177463247 21:21440479-21440501 CAGGACCAACCTGGGCAACATGG + Intronic
1178894919 21:36550334-36550356 GAGGAGCCAAGTTGGTATCATGG - Intronic
1179378866 21:40879995-40880017 CAGGACCAACCTGGCTAACACGG + Intergenic
1179801226 21:43812322-43812344 CGGGACCCACGTGACCATCAAGG - Intergenic
1180940192 22:19655776-19655798 CAGGACCCATGTGGGCAACCAGG + Intergenic
1180940891 22:19658992-19659014 CAGATCCCACGTGGATATCTAGG + Intergenic
1181049563 22:20232084-20232106 CAGGAACCGAGTGGCTATCAGGG + Intergenic
1181113371 22:20615513-20615535 CAAGAGCCATCTGGGTATCATGG + Intergenic
1181711420 22:24694256-24694278 CAGGACCCATGTGGGCAACCAGG - Intergenic
1183454521 22:37914840-37914862 CAAGACCAACCTGGGTAACATGG - Intronic
1185070107 22:48651464-48651486 CAGGACCCAGGTGGCTCGCAAGG - Intronic
950507447 3:13403993-13404015 CAGGACCTGCATGGGAATCAGGG + Intronic
954229170 3:49203065-49203087 CAAGACCCACCTGGGCAACATGG - Intronic
954943134 3:54393352-54393374 CAGTACCCACATGGGTCACAGGG - Intronic
955384538 3:58468947-58468969 CAGGACCAACGTGGCGGTCATGG + Intergenic
955717561 3:61846712-61846734 CAAGACCAACCTGGGTAACATGG + Intronic
957324269 3:78672376-78672398 CAAAACCCACCTGGGTAACATGG + Intronic
961544200 3:127620927-127620949 GAGGCCACACGTGGGTATCCAGG + Intronic
964662252 3:159133174-159133196 CAGGACACATGTGGTTCTCAGGG + Intronic
965500965 3:169456215-169456237 CAGGACCCAGGTGTGAATGAAGG - Intronic
966831029 3:184009063-184009085 CAAGACCAACCTGGGCATCATGG - Intronic
968551251 4:1224544-1224566 CAGCACACACGTGGGCCTCACGG - Intronic
968652608 4:1766207-1766229 CAGGTCCCACCAGGGTATTAGGG + Intergenic
970164723 4:13224177-13224199 CATGACCCACCTGGGAATCTTGG - Intergenic
971033397 4:22666238-22666260 CTGGACCCACATGGGCAACATGG + Intergenic
972340248 4:38146484-38146506 AAGGACACACGTGGGAAACAAGG + Intergenic
972410570 4:38789661-38789683 CAAGACCAACCTGGGTAACATGG - Intergenic
972771403 4:42200647-42200669 CAGGACCAACCTGGGCAACATGG - Intergenic
974156654 4:58082378-58082400 CAGGACCTACCTGGGCAACACGG - Intergenic
978916780 4:114135326-114135348 CAGGACCCAGGTGGTTTTAATGG + Intergenic
980350013 4:131672061-131672083 CAGGACCAGCCTGGGTAACAGGG - Intergenic
984878617 4:184391048-184391070 CAGGACCCATGTGGGCATTGTGG - Intronic
985850266 5:2383477-2383499 CAGGATCCACGTGTGTTTCCTGG - Intergenic
988709234 5:33756786-33756808 CATGACCCAAGCAGGTATCAGGG + Intronic
991719964 5:69486163-69486185 CAAGACCAACCTGGGTAACATGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
999002457 5:147939354-147939376 CAGGCCCCAGGTGGGTGCCAAGG + Intergenic
1000089342 5:157916761-157916783 CAAGACCCACCTGGGCAACATGG + Intergenic
1000091824 5:157936344-157936366 CAAGACCAACCTGGGTAACATGG - Intergenic
1001756138 5:174171757-174171779 CAGGACCCAGGTGGGGAGAAGGG - Intronic
1001982050 5:176044461-176044483 CAGGCCCCAAGTAAGTATCAGGG - Intergenic
1002235412 5:177799596-177799618 CAGGCCCCAAGTAAGTATCAGGG + Intergenic
1002412622 5:179095423-179095445 CAAGACCAACGTGGATAACATGG - Intergenic
1002699342 5:181111435-181111457 CAAGACCCACCTGGGCAACATGG - Intergenic
1003458035 6:6301899-6301921 CAGGGCCCCCGTGGATCTCAAGG - Intronic
1003560189 6:7173594-7173616 CAAGACCCACCTGGGCAACATGG + Intronic
1004142538 6:13032807-13032829 CAAGACCAACCTGGGTAACATGG - Intronic
1006487090 6:34351992-34352014 CAAGACCCACATGGGCAACATGG + Intronic
1007649735 6:43411817-43411839 CAAGACCCACCTGGGTAATATGG + Intergenic
1007778658 6:44238263-44238285 CACGACCCACGCGGTTGTCAGGG - Intergenic
1014583113 6:123162333-123162355 CTGGACCCACGTGGGTCTTAGGG + Intergenic
1014908092 6:127055328-127055350 CAGGACCAACCTGGGCAACATGG - Intergenic
1015524816 6:134166194-134166216 CAGGACCAGCCTGGGCATCATGG + Intergenic
1017158206 6:151341478-151341500 CAGGACCCCCGGGGGTTTCCTGG + Intronic
1017821450 6:158051744-158051766 CAAGACCAACGTGGGCAGCATGG + Intronic
1024942426 7:54776523-54776545 AAGAACCCACGTGATTATCAGGG + Intergenic
1026575148 7:71565532-71565554 CAGGGACCAACTGGGTATCAGGG - Intronic
1026886133 7:73947552-73947574 CAAGACCAACCTGGGTAACATGG - Intergenic
1027198063 7:76044894-76044916 CAGGACCAGCCTGGGTAACATGG - Intronic
1027407921 7:77881569-77881591 CAAGACCAACGTGGGCAACATGG - Intronic
1028843277 7:95451847-95451869 CAAGACCCACCTGGCTAACATGG - Intergenic
1030041989 7:105459866-105459888 CAAGACCAGCGTGGGTAACATGG + Intronic
1030221416 7:107102869-107102891 CAAGACCCACCTGGGCAACATGG - Intronic
1031980502 7:128121480-128121502 CAGGACACACGGGGGCCTCAGGG + Intergenic
1032594272 7:133223813-133223835 CAGGTCCCACATGGGGATTATGG + Intergenic
1033059210 7:138089145-138089167 CAAGACCAACCTGGGTAACATGG + Intronic
1033359641 7:140629477-140629499 CAGGACTCACGTGGGAGCCAGGG + Intronic
1035427814 7:158792968-158792990 CAGGACCATCGTGGCTAACATGG - Intronic
1038999175 8:32960442-32960464 CGAGACCCACCTGGGCATCATGG + Intergenic
1039631785 8:39120559-39120581 CAAGACCAACCTGGGTAACATGG + Intronic
1041325745 8:56662053-56662075 CAGGACCCATATGTGTACCAGGG - Intergenic
1045479863 8:102583235-102583257 CAAGACCAACGTGGCTAACACGG + Intergenic
1046856316 8:119035795-119035817 CAGGACCCTGGTAGCTATCAAGG + Intronic
1048532973 8:135267139-135267161 CAGGACACAGGTGCGTAACAAGG - Intergenic
1048654348 8:136518791-136518813 CAAGACCAACCTGGGTAACATGG - Intergenic
1049576760 8:143393267-143393289 CAGGTCTCATGTGGGTATCTGGG + Intergenic
1051768396 9:20549013-20549035 CGGGACCCACCTGGGCAACATGG - Intronic
1053281473 9:36822765-36822787 CAGGAGCCACGTGGACATTAAGG - Intergenic
1053379870 9:37639859-37639881 CAGGACCAGCCTGGGTAACATGG - Intronic
1053380009 9:37641086-37641108 CAGGACCAGCCTGGGTAACATGG - Intronic
1053879512 9:42578026-42578048 CAGGACCAGCGTGGGCAGCAAGG - Intergenic
1057733510 9:97632582-97632604 CAAGACCCACCTGGGCAACAAGG - Intronic
1058401878 9:104628884-104628906 CAGAACACACGTGAGTAGCAAGG - Intergenic
1059634349 9:116156881-116156903 CAGGACCGAGGTGGGCAGCAAGG + Intronic
1060328004 9:122636412-122636434 CAAGACCCACCTGGGCAACACGG + Intergenic
1062532206 9:137006955-137006977 CAGGCCCCACGTGGGCAGCAAGG + Intergenic
1203632104 Un_KI270750v1:80071-80093 CAGGCCCCAGGTGGACATCAGGG + Intergenic
1188466424 X:30486727-30486749 CAAGACCAACATGGGTAACACGG - Intergenic
1197723824 X:129762424-129762446 CAGGACCCAAGTGGGTTTTTAGG + Intronic
1199419844 X:147632089-147632111 CAAGACCAACCTGGGTAACATGG + Intergenic
1201959251 Y:19660648-19660670 GAGGGCCCAAGTGGGAATCATGG - Intergenic