ID: 915025793

View in Genome Browser
Species Human (GRCh38)
Location 1:152828211-152828233
Sequence ATGGCTAAAGATATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915025787_915025793 19 Left 915025787 1:152828169-152828191 CCTGCTGCCTGGAAGCTTTGGAA 0: 1
1: 0
2: 1
3: 26
4: 234
Right 915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 305
915025788_915025793 12 Left 915025788 1:152828176-152828198 CCTGGAAGCTTTGGAAATCAAGA 0: 1
1: 0
2: 1
3: 17
4: 258
Right 915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915025793 Original CRISPR ATGGCTAAAGATATGGAGGA GGG Intergenic
901955704 1:12783764-12783786 ATGTTAAAAGATATGAAGGAAGG - Intergenic
901979077 1:13019814-13019836 ATGTTAAAAGATATGAAGGAAGG - Intronic
902003005 1:13209124-13209146 ATGTTAAAAGATATGAAGGAAGG + Intergenic
902022230 1:13354888-13354910 ATGTTAAAAGATATGAAGGAAGG + Intergenic
902959003 1:19948735-19948757 AGGGGTAAAGGTTTGGAGGAGGG + Intergenic
903363213 1:22790140-22790162 ATGGGTGAAGGTAGGGAGGAAGG + Intronic
903466766 1:23557335-23557357 ATGGATAAAGATTTGGATGCTGG - Intergenic
903656903 1:24955064-24955086 ATGGGCAAAGGTATGGAAGAAGG - Intronic
904853703 1:33479096-33479118 GTGGCGGAAGATATGGGGGAAGG + Intronic
905007927 1:34725967-34725989 ATGGACAAAGATCTGGAGGTGGG - Intronic
905257783 1:36696209-36696231 ATGGCTAAAAATATGGACTCTGG - Intergenic
905487669 1:38315408-38315430 ATAGTGCAAGATATGGAGGAAGG - Intergenic
909108311 1:71441316-71441338 ATGGCGAAGGGTATGGAAGAAGG - Intronic
909168300 1:72257538-72257560 ATCTTTAAATATATGGAGGAGGG - Intronic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911173116 1:94791428-94791450 ATTGCTATAGATTTGGAAGATGG - Intergenic
911645934 1:100337231-100337253 ATAGGGAAAGGTATGGAGGAAGG - Intergenic
914175752 1:145278794-145278816 ATTGCTCAAGTTATGGAGGATGG + Intergenic
915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG + Intergenic
915236916 1:154490576-154490598 ATGAGTGAAGATATGGAGGTGGG + Intronic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
917423001 1:174884749-174884771 ATGGCAAGAGATAGGGAGAATGG - Intronic
917920674 1:179747092-179747114 AGGGCAAAAGATACGTAGGAGGG + Intronic
918139552 1:181709026-181709048 ATGGATCAAGATAGTGAGGATGG + Intronic
918617374 1:186561243-186561265 AAGGATAAAGGCATGGAGGAAGG + Intergenic
918815219 1:189172428-189172450 ATGGCAAAAGAAGTGCAGGAGGG + Intergenic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
924111665 1:240705671-240705693 ATGGCAAAAGAAAAGAAGGAAGG + Intergenic
924276348 1:242391248-242391270 GTGTCAAAAGCTATGGAGGAGGG + Intronic
1063098649 10:2930674-2930696 AAGGCTAAAGAAATAAAGGAAGG + Intergenic
1063269008 10:4486182-4486204 GTGGCGGCAGATATGGAGGAGGG - Intergenic
1065413202 10:25453360-25453382 ATTAGAAAAGATATGGAGGAAGG - Intronic
1065654121 10:27929003-27929025 ATGGCTAAACATATGGATTCTGG - Intronic
1068376134 10:56183499-56183521 AAGGCTAAAGATATAGTGAAAGG + Intergenic
1068940763 10:62678614-62678636 ATGGCAAAGGATTTGGAGGAGGG - Intergenic
1070440341 10:76436727-76436749 ATGGCTAAAGATAAAGTGAATGG - Intronic
1071275283 10:84048674-84048696 TTGTCTAAAGATCTGGAGGTGGG + Intergenic
1071380450 10:85053760-85053782 ATAGCTCAAGATATGGGGAATGG - Intergenic
1073926996 10:108528069-108528091 ATGCCTTAAGAAATGAAGGAAGG - Intergenic
1074198258 10:111208091-111208113 ATGGCAGATGACATGGAGGAAGG + Intergenic
1074871163 10:117577238-117577260 ATGGCTAAAGCATTAGAGGAGGG + Intergenic
1075940925 10:126389305-126389327 ATGGCTGGAGCTATGGAGGATGG + Intergenic
1075998376 10:126896001-126896023 ATGTCTAAAGAAAGGAAGGAAGG - Intergenic
1077586140 11:3454834-3454856 ATGTTAAAAGATATGAAGGAAGG - Intergenic
1077861248 11:6182224-6182246 ATGGCTAAAGAAATGCTGAAAGG + Intergenic
1078811087 11:14764141-14764163 ATTGCCAAAGGTATGAAGGAAGG + Intronic
1078843659 11:15102274-15102296 ATGGCAGAAGAGATGGAGGGGGG + Intergenic
1078886632 11:15506873-15506895 AGGAATGAAGATATGGAGGAGGG + Intergenic
1081097130 11:38951015-38951037 ATGAATAGAGATATCGAGGAAGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1085836829 11:79965986-79966008 GTGGCTAAAGAAGAGGAGGAGGG - Intergenic
1086032342 11:82375347-82375369 GTGGATGAAGATATGGGGGAAGG - Intergenic
1087202226 11:95357347-95357369 ATGGCCAGAGGAATGGAGGAGGG + Intergenic
1088369062 11:109068572-109068594 ATGTTTAAAGATTTAGAGGAAGG + Intergenic
1088489745 11:110375386-110375408 ATGGGCAAAGACATGGAGTAGGG - Intergenic
1088611768 11:111584465-111584487 AAGGCAAGAGATATGGAGAATGG + Intergenic
1089143826 11:116309840-116309862 ATGGCTAAAGGGATGGAAAAGGG - Intergenic
1089940209 11:122408621-122408643 ATGAATAAAGATGTGAAGGAGGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093698573 12:22191498-22191520 ATGGCTAAAGAAATGTAGCAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094719169 12:33044931-33044953 AAGGCTAATGAGATAGAGGAGGG - Intergenic
1095540848 12:43307067-43307089 ATGGCTAATGATGTGGAGCCAGG - Intergenic
1097440625 12:59603434-59603456 ATGGCCAAAGATTTGGCGGTAGG - Intronic
1097952262 12:65444932-65444954 CTGGATAAGGATATGTAGGAGGG - Intronic
1098919500 12:76290844-76290866 ATGAATAAAAATATGGAGGTGGG + Intergenic
1099925039 12:89006935-89006957 ATTTCTAAAGGTAGGGAGGAGGG + Intergenic
1100083472 12:90879418-90879440 ATGGCTAAAGAAGTGCAGCAGGG + Intergenic
1102426241 12:112846511-112846533 ATGGCAGAAGATGGGGAGGAGGG + Intronic
1102429072 12:112867618-112867640 AAGGCTGAAGAGATAGAGGAGGG + Intronic
1104453007 12:128886601-128886623 ATGGCTCTGGACATGGAGGAAGG - Intronic
1105390211 13:19969570-19969592 ATAACTCAAGATATGAAGGAAGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106910178 13:34454820-34454842 AAGGCAAAAGATATGGACAAGGG + Intergenic
1107135014 13:36934378-36934400 ATGGCTAATGATGTTGAGTATGG + Intergenic
1107418539 13:40223695-40223717 CTGGCTAATGATCTGGAGGAGGG - Intergenic
1107747285 13:43524052-43524074 ATGGCTGTAGCCATGGAGGATGG - Intronic
1107966526 13:45603033-45603055 GAGGCTTAAGACATGGAGGAGGG + Intronic
1108483797 13:50904547-50904569 ATGACTGAAGCTATTGAGGAAGG - Intergenic
1108798499 13:54064127-54064149 ATGGCTATTGAAATGGAAGAGGG - Intergenic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1109793943 13:67285524-67285546 ATGGATAAACTTATGGGGGAGGG + Intergenic
1109980863 13:69904386-69904408 ATTTATAAAGATATTGAGGAGGG - Intronic
1110398877 13:75066285-75066307 AGGCATAAAGAGATGGAGGATGG + Intergenic
1110737710 13:78957228-78957250 ATGGCTACAGATGTGATGGATGG + Intergenic
1111065234 13:83082472-83082494 ATGGCTAAACTTAGTGAGGAAGG - Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113245181 13:108387525-108387547 ATGGCTAGATTTTTGGAGGAAGG + Intergenic
1113421886 13:110177313-110177335 AGTGATAAAGATATGTAGGAAGG - Intronic
1116025874 14:39514088-39514110 ATGACTATAGATATAGATGAGGG + Intergenic
1117237741 14:53796662-53796684 ATGGCAAAGAAAATGGAGGACGG - Intergenic
1117941240 14:60967776-60967798 ATAGCTAAACAAATGGAAGAGGG - Intronic
1119803091 14:77462850-77462872 ATGGGTAAAGATTTGGGGGGAGG + Intronic
1119979274 14:79061384-79061406 CTGGCTAGAGATAGGAAGGAGGG + Intronic
1120959584 14:90112175-90112197 ATCGCTAGAGATACGCAGGACGG - Intronic
1121117631 14:91354892-91354914 GTGCCAAAAGATATGGAGAAGGG + Intronic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124393921 15:29284013-29284035 AAGGATCAAGATATGGAGGGTGG + Intronic
1124690539 15:31817994-31818016 ATGGCAGAAGAGATGGAAGAGGG - Intronic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1125244012 15:37613153-37613175 GAGGCTAAAGATGTGGATGAGGG - Intergenic
1125361530 15:38869649-38869671 AAGGCTAAACTTATGGAGGTGGG - Intergenic
1126018031 15:44372299-44372321 ATGGCTATAGAGAAGGAGTATGG - Intronic
1126394736 15:48202586-48202608 ATTGCTGAAGACATGCAGGATGG - Exonic
1126687310 15:51259657-51259679 ATTGTTAAAGATGTTGAGGAAGG - Intronic
1127232763 15:57014816-57014838 ATGGGTCAAGATATGGGGGTGGG + Intronic
1127395801 15:58543153-58543175 ATGGCCCAAGATATCCAGGAAGG + Intronic
1127697609 15:61466782-61466804 ATGGCAAAAGATATGGACATAGG + Intergenic
1128127006 15:65200611-65200633 ATGGGTAAAGATATAGAAGTGGG - Intronic
1130353603 15:83111213-83111235 ATGGGTGAATGTATGGAGGATGG - Intronic
1133899304 16:9958453-9958475 ATTGCTAAAGATATGGAAGTGGG - Intronic
1134558675 16:15188402-15188424 ATGGACAAAGATGTGGAGGTGGG - Intergenic
1134919206 16:18100004-18100026 ATGGACAAAGATGTGGAGGTGGG - Intergenic
1135073577 16:19373699-19373721 CTGGCTCAGAATATGGAGGAGGG + Intergenic
1138085591 16:54131144-54131166 ATGCTTAAAGATCTGGAAGAAGG + Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1142248251 16:88979501-88979523 ATGGCCAGAGAACTGGAGGAGGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1148698193 17:49573634-49573656 ATGACTAAAGGTCTGGAGGCTGG - Intergenic
1149263985 17:54907917-54907939 ATGGAAGAAGATATGGAGGTGGG - Intronic
1149959883 17:61096975-61096997 ATGGCAAAAGAAATGCATGAAGG + Intronic
1150199689 17:63341977-63341999 ATGAGTAAATATATGGAGGTGGG - Intronic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1151176095 17:72289295-72289317 ATGGATAAATATATGGATGCGGG + Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1157530679 18:48418166-48418188 ATTGCTACAGACCTGGAGGAGGG + Intergenic
1158318695 18:56239860-56239882 ATGGCTAAATATAGGTAAGATGG - Intergenic
1158500605 18:57997361-57997383 CTGGCTTAAGAAATGGAGGAAGG - Intergenic
1158758534 18:60355943-60355965 ATGGGGAAAGAAATGGAGGGAGG - Intergenic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1160015997 18:75141216-75141238 ATGGCTTTGAATATGGAGGAAGG + Intergenic
1161719289 19:5894314-5894336 ATGGCTCAAGATCTGCAGGGGGG + Intronic
1162365344 19:10245360-10245382 GCGGCTAAAGCCATGGAGGAAGG + Intergenic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163347763 19:16754739-16754761 ATGGCTATAGAGATGATGGATGG - Intronic
1163594179 19:18211337-18211359 TTGGCTAAAGATCTGGAGGCTGG - Intronic
1163594632 19:18213877-18213899 GTGGCTAAAGATCTGGAGGCTGG - Intronic
1164766192 19:30773378-30773400 ATGCCTAAAGCCATGAAGGAGGG - Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1166201413 19:41239962-41239984 ATGGATAGATATATGGAGGGTGG + Intronic
1168345856 19:55649927-55649949 TTGGCCAAAGAGATGAAGGAAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925529967 2:4848672-4848694 ATGGCAGTTGATATGGAGGATGG + Intergenic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
926948997 2:18220906-18220928 AGGGCTAAAGAAAAGGGGGATGG + Intronic
930218348 2:48720313-48720335 AAGGCAGAAGACATGGAGGAGGG - Intronic
931552544 2:63462637-63462659 CTGGCTAAAAATATGCAGAAAGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
931814150 2:65883882-65883904 ATAGGCAAAGATGTGGAGGAAGG - Intergenic
931991444 2:67794415-67794437 ATGGCTATAGATATAGATTAAGG + Intergenic
932174482 2:69586999-69587021 AAGGCAGAAGATATGGAAGAAGG - Intronic
932675371 2:73775990-73776012 ATGTCTACATATATGAAGGATGG + Intronic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933168643 2:79100470-79100492 ATAGCTAAACATAAGCAGGAGGG - Intergenic
934119306 2:88824927-88824949 ATGGGAAGAGATAAGGAGGATGG + Intergenic
936162772 2:110097450-110097472 ATGGGAAGAGATAAGGAGGATGG + Intronic
937613687 2:123894018-123894040 ATGGAAAGAGATATTGAGGAGGG - Intergenic
937635400 2:124150400-124150422 CTGGCTATAGATATGGATTATGG + Intronic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
943102135 2:183499840-183499862 ACCGGTAAGGATATGGAGGAAGG - Intergenic
944502836 2:200379528-200379550 ATAGCTAAAGAGATGGGGGAAGG + Intronic
944601976 2:201312683-201312705 AAGGCTACAGAGATGGTGGACGG + Intronic
944626699 2:201576948-201576970 ATGACTATAGATATTGAGCAGGG - Intronic
944864875 2:203850310-203850332 ATGGCTAGACATATGGAAGTGGG + Intergenic
945717670 2:213379462-213379484 ATGGCTAAAGAAGTGCAGCATGG - Intronic
946894842 2:224313035-224313057 GGGGATAAAGTTATGGAGGAAGG - Intergenic
947755415 2:232560146-232560168 ATGGGGGAAGGTATGGAGGAAGG - Intronic
1169684039 20:8250494-8250516 ATGGCAAAAGATATGATGAAGGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170705242 20:18738568-18738590 ATGGCCAAGGATAGGAAGGAAGG + Intronic
1173651817 20:44671181-44671203 AAGGGTAGAGATATGGAGAAGGG - Intergenic
1173653698 20:44684341-44684363 ATGGGTAGAGAAATGAAGGAAGG + Intergenic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1175647701 20:60689085-60689107 ATGGCTGAAGATGTGGAAAATGG - Intergenic
1175745775 20:61455995-61456017 ATGGATAGATATATGGAGGGAGG + Intronic
1176782085 21:13208424-13208446 ATGGCTAAAGAATTGTAGGCCGG - Intergenic
1176818092 21:13626612-13626634 AGGGCTAAAGATGTAGAGTAGGG - Intronic
1178151826 21:29803793-29803815 TTGGATAAAGCAATGGAGGAAGG - Intronic
1178726426 21:35056593-35056615 ATAGATAAGGAAATGGAGGAAGG - Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179567519 21:42258429-42258451 ATGGAGGAAGATATGGAGGGAGG - Intronic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1182805106 22:33062953-33062975 ATAGCTGAAGAAATGGAGGGTGG + Intergenic
1182941091 22:34278190-34278212 AAGCCTAAAGATAAGGAGCAGGG - Intergenic
1183022631 22:35039548-35039570 TTGGCTAAAGAAATAGAAGATGG - Intergenic
1183789674 22:40056125-40056147 ATGGCTAGAGATGGGGTGGATGG - Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
956036138 3:65094451-65094473 GAGGCTAAAGATTTGGAGGCAGG - Intergenic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
957859033 3:85919384-85919406 ATGGCTGAAGGAAAGGAGGAAGG + Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963149986 3:142035278-142035300 ATGCTTAAAGATTTGGAGGCAGG - Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
963485194 3:145927090-145927112 ATGTCTACAGAGATGGATGAGGG + Intergenic
964443831 3:156739855-156739877 AAGGCAAAAGAAATGGGGGAGGG - Intergenic
965063836 3:163817764-163817786 GTGGCTAAAGATTTAGAGAATGG - Intergenic
966555448 3:181254417-181254439 GTGTATAAAGATATGGAAGAAGG + Intergenic
968598469 4:1497552-1497574 ATGGATGAAGATATGGATGATGG + Intergenic
969001325 4:3984789-3984811 ATGTTAAAAGATATGAAGGAAGG - Intergenic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969812593 4:9660073-9660095 ATGTTAAAAGATATGAAGGAAGG + Intergenic
970580587 4:17470988-17471010 TGGGCTAAAGCAATGGAGGAAGG + Intronic
971375080 4:26049933-26049955 TGGGTTCAAGATATGGAGGATGG + Intergenic
972201135 4:36715979-36716001 ATGGCTAAAGACATGTGGCAGGG - Intergenic
972280490 4:37597501-37597523 ATTCCTAAAGCTATGGAGAAAGG + Intronic
972643118 4:40943320-40943342 ATGGCTAAAGGTTTGGAATAGGG + Intronic
973242178 4:47968832-47968854 ATGAGTAAAGATATAGAGGCAGG + Intronic
974195121 4:58564358-58564380 GTGGGTCAAGATATGGAGGGTGG - Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
976919320 4:90418025-90418047 ATGGTTAAAAATATGGATGCTGG + Intronic
977245214 4:94622963-94622985 ATAGTTAAAGAAATGGAGGCCGG - Intronic
977999275 4:103537222-103537244 ATGGTTAATGATAGGGATGAGGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986511589 5:8512752-8512774 ATGGCAAAAGATGAAGAGGAAGG + Intergenic
987738094 5:21870681-21870703 TTGGCTGAAGATAAAGAGGATGG - Intronic
988779552 5:34507784-34507806 ATGGGTCAAGATTTGGGGGATGG + Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
991922556 5:71671317-71671339 ATGGATAAAGAAAGAGAGGAAGG - Intergenic
992355265 5:75975410-75975432 ATGTCTATAGACATGGAGCAAGG - Intergenic
993011303 5:82486284-82486306 ATGAATCAAGATATGGAGGTGGG + Intergenic
993481757 5:88432250-88432272 AAGGATAAAGAAATGGATGAAGG - Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
994993555 5:107030086-107030108 ATGAGTAATGATATGGAAGAAGG + Intergenic
996412997 5:123179399-123179421 ATGGATAAATATTTGGAGGAGGG + Intronic
996666447 5:126065816-126065838 ATGGCAAGAGGTATTGAGGAGGG + Intergenic
996960757 5:129246393-129246415 ATGGCTAAAAATGGGGAGAAGGG - Intergenic
998733278 5:145106033-145106055 ATGGACAAAGAGGTGGAGGAAGG - Intergenic
999151257 5:149427688-149427710 ATGGCTAAAGAAGTAAAGGAGGG + Intergenic
999651972 5:153776727-153776749 CTGGCTAAAGAAAAGGAGGGTGG + Intronic
999752826 5:154642460-154642482 ATGTTAAAAGATATGAAGGAAGG - Intergenic
1000058726 5:157633568-157633590 TTGCCTAAACTTATGGAGGAGGG - Intronic
1000277487 5:159751366-159751388 ATGTCAAAGGATATGGATGAAGG - Intergenic
1000662175 5:163950532-163950554 AGGGCTTGAGATAGGGAGGAGGG - Intergenic
1003617804 6:7671026-7671048 ATGACAGAAGAGATGGAGGAGGG - Intergenic
1003863312 6:10341533-10341555 ATTGCTAAGGAAAGGGAGGAAGG + Intergenic
1004138943 6:12997408-12997430 ATAGATAAATATATGGGGGATGG + Intronic
1004274439 6:14222902-14222924 GTGGCTAAAGAAATGGAAGGTGG + Intergenic
1006234456 6:32616373-32616395 ATGGCTAAAGAAGTGAAGGAAGG + Intergenic
1007166963 6:39835608-39835630 ATGAACAAACATATGGAGGAAGG + Intronic
1007572260 6:42901449-42901471 ATGTTAAAAGATATGAAGGAAGG - Intergenic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1009810853 6:68664495-68664517 ATGGCTAAGAACATGGAAGAGGG + Intronic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1012247583 6:96942961-96942983 AGGGCTAGAGATTTAGAGGAGGG + Intronic
1012300116 6:97576787-97576809 ATGAATAAAGCTATGAAGGAAGG - Intergenic
1012420336 6:99057708-99057730 ATTGCTAAAGAAAGGGAGGAAGG - Intergenic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014652151 6:124052998-124053020 ATGGGTAGAGATGTGGATGAGGG + Intronic
1015001458 6:128221591-128221613 ATGATTTAAGATATGGAGAAAGG - Intronic
1017754203 6:157515764-157515786 GTGGCTAAAGAAATGAAGGGTGG - Intronic
1017815623 6:158014608-158014630 CTGCCTAGAGAAATGGAGGAAGG + Intronic
1019295492 7:271954-271976 ACGGCTGAGGATGTGGAGGAGGG + Intergenic
1019295508 7:272018-272040 ACGGCTGATGATGTGGAGGAGGG + Intergenic
1021289134 7:18821961-18821983 ATGGGAAGAGGTATGGAGGAGGG + Intronic
1022475771 7:30708564-30708586 ATGGTAAGAGATATGGATGAGGG - Intronic
1022643853 7:32212783-32212805 ATGGGCAAAGATCTGGGGGATGG - Intronic
1022984397 7:35636724-35636746 ATGGGGAAAGGTCTGGAGGAAGG + Intronic
1023242102 7:38159690-38159712 AGGGCAAAAGAGATGGAGGCGGG + Intergenic
1028825480 7:95268203-95268225 ATGACCAAAGATATAGAGGAGGG - Intronic
1030199757 7:106890847-106890869 ATGGGGGAAGATGTGGAGGAAGG - Intronic
1031255446 7:119441665-119441687 ATGGATAAATATATGTAGGAAGG - Intergenic
1031651537 7:124297090-124297112 TGGGTTAAAGGTATGGAGGATGG - Intergenic
1032542725 7:132716728-132716750 ATGGCTGAAGATATGGACAATGG - Intronic
1033418198 7:141182848-141182870 ATGGCTAAGGAAACGGTGGAAGG - Intronic
1035601534 8:899969-899991 AAGGCAGAAGACATGGAGGATGG + Intergenic
1036084786 8:5601498-5601520 ATGGCAAAAGATGAGGAGGCTGG + Intergenic
1037364419 8:18107054-18107076 ATGGCTAAAGAAGTGTAGCAGGG - Intergenic
1040719373 8:50298517-50298539 ATGGCATAAGATAAGGATGAAGG + Intronic
1040987257 8:53309368-53309390 ATGGGTATGGATATGGAGAAAGG - Intergenic
1041673271 8:60514332-60514354 ATGGCTTTAGATTTGGAGGCTGG + Intergenic
1042654583 8:71082133-71082155 ATGGCTAGGGAGATGAAGGAGGG + Intergenic
1042985011 8:74573834-74573856 AAGGCTAAAGACATGGATGGAGG - Intergenic
1043534690 8:81189669-81189691 ATGGCTAAAAGTATAGAGGTGGG - Intergenic
1043957189 8:86374425-86374447 ATGGCTAAATGTATGTAAGAAGG - Intronic
1045490821 8:102667667-102667689 ACAGCTGAAGATAGGGAGGAAGG + Intergenic
1046619921 8:116518181-116518203 ATGACTAAAAATATGCTGGAGGG - Intergenic
1047083725 8:121493498-121493520 ATGGGGAAAGATCTGGAGGCAGG + Intergenic
1048348270 8:133594982-133595004 ATGGCTAAAGAGAGAGAGGAAGG - Intergenic
1048498499 8:134955588-134955610 ATGGCTAAGGATTTGGAGAAAGG - Intergenic
1050267466 9:3906000-3906022 ATGGAGCAAGATATGGAGAAAGG + Intronic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1055538200 9:77271275-77271297 ATGGCTAAAAATAAGAAGAATGG + Intronic
1055669554 9:78589124-78589146 TTGCCTAAAGATATGGCAGAGGG + Intergenic
1056006151 9:82273472-82273494 ATGACTGAAGGTATGGAGGTGGG + Intergenic
1056339211 9:85608131-85608153 ATGAGCAAAGATATAGAGGATGG + Intronic
1057056181 9:91962890-91962912 ATGTCTAAAGAAATAGAGTATGG - Intergenic
1060906578 9:127312550-127312572 ATGACAAAAGATTTGGAGAATGG + Intronic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1060941170 9:127543682-127543704 ATGGATGAAGATGTGGAGGTAGG - Intronic
1061133918 9:128722799-128722821 ATTGCTAAAGAAATGGATCAGGG + Intronic
1203529267 Un_GL000213v1:122892-122914 AGGGCTAAAGATGTAGAGTAGGG + Intergenic
1185975088 X:4711224-4711246 TTGAGTAAAGAAATGGAGGAGGG + Intergenic
1186056773 X:5657535-5657557 ATGGGCAAAGATTTGGAGGCAGG + Intergenic
1186611539 X:11142720-11142742 TTGGCTTAAAAGATGGAGGAAGG + Intronic
1187576819 X:20565520-20565542 ATAGCTCTAGATTTGGAGGAAGG + Intergenic
1187980804 X:24754944-24754966 AAACCTAAAGATATGGATGATGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188437945 X:30184359-30184381 ATGGGTAAAGATATGGAGTTGGG - Intergenic
1190035168 X:47016144-47016166 CTGGCTAATGATATGTAGGTAGG - Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1192093511 X:68185774-68185796 AAGGCTAAAGAAAAGGAGAAAGG + Intronic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1193660072 X:84246745-84246767 ATTGGTTAAGATAAGGAGGATGG + Intergenic
1194829874 X:98609549-98609571 TGGGCTAAAGATATGATGGAAGG - Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1200753058 Y:6964741-6964763 ATGTTAAAAGATATGAAGGAAGG - Intronic
1201559371 Y:15300106-15300128 GTAGCCAAAGATATGTAGGAGGG - Intergenic
1201701460 Y:16886852-16886874 TTGAGTAAAGAAATGGAGGAAGG - Intergenic