ID: 915027475

View in Genome Browser
Species Human (GRCh38)
Location 1:152844228-152844250
Sequence CTGTGTTTACAGATGTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915027472_915027475 -5 Left 915027472 1:152844210-152844232 CCTACTGTGTACTGGCCTCTGTG 0: 1
1: 0
2: 9
3: 90
4: 548
Right 915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 226
915027470_915027475 25 Left 915027470 1:152844180-152844202 CCAAAGACTACAATAAACATATG 0: 1
1: 0
2: 2
3: 29
4: 306
Right 915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915027475 Original CRISPR CTGTGTTTACAGATGTAAGT GGG Intergenic
900660988 1:3783559-3783581 CTGTGTTTACAGAAATCACTGGG + Intronic
908774070 1:67623452-67623474 CTGTGTTCACATAAGTAAGTAGG + Intergenic
909495430 1:76272363-76272385 CTGACTTTACAGATATAATTTGG - Intronic
909952037 1:81732037-81732059 CTGTGTTAACAGCAATAAGTAGG - Intronic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
910651073 1:89568096-89568118 CTGATTTTACAAATGTAAGACGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915001134 1:152592980-152593002 CTTTTTTTGCTGATGTAAGTGGG + Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915157867 1:153893336-153893358 CTGGGATTACAGATGTGAGCCGG - Intronic
916764499 1:167847218-167847240 CTGTGTCTACTAATGTAAGAAGG - Intronic
916894309 1:169146160-169146182 CTGTGTTCTCACTTGTAAGTGGG - Intronic
917429726 1:174953523-174953545 CTGTCATTACAGATGAGAGTGGG - Intronic
919103361 1:193121155-193121177 CTGTGTTCCAAGATGTAAATGGG - Intergenic
919566464 1:199194970-199194992 CTGTGTTCTCAGTTGTAAGTGGG - Intergenic
920165651 1:204033857-204033879 CTGGCTTTGCAGATGTAAGGAGG - Intergenic
922844521 1:228673348-228673370 ATGTTTTTGCAGTTGTAAGTTGG + Intergenic
922907278 1:229183784-229183806 ATGTGTGTGCAGATGTGAGTGGG - Intergenic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1065000993 10:21337376-21337398 CCATGTTTTCATATGTAAGTGGG - Intergenic
1066179490 10:32946069-32946091 CTATGTTTTCAGATGTTACTCGG + Intronic
1067858927 10:49824214-49824236 CAGTGTTTACTGATGTATCTAGG - Intronic
1068151354 10:53136290-53136312 CTTTGTTTACAGTTGTAGTTTGG + Intergenic
1069068180 10:63967560-63967582 CTGTCATTTCAAATGTAAGTAGG + Intergenic
1070422756 10:76253137-76253159 TTGAGTTTTCAGATCTAAGTGGG + Intronic
1071092616 10:81936536-81936558 TTGTGTGTACAGAAGTGAGTGGG + Intronic
1071143489 10:82540472-82540494 GTGTGTGTAAAGATGTGAGTGGG + Intronic
1075508083 10:123043711-123043733 ATGTCTTTACAGATGTCACTGGG + Intronic
1076291849 10:129351560-129351582 CTGACTTTGCAGATGTAATTCGG + Intergenic
1078134272 11:8639288-8639310 CTGTGATTACAGATTTAAAGGGG + Intronic
1078156397 11:8803729-8803751 CTCTGTTTTCATCTGTAAGTTGG - Intronic
1078876202 11:15400757-15400779 CTCTGTCTACTGATGTGAGTGGG + Intergenic
1080189799 11:29530870-29530892 GTGTGTTTACAGATGCAAACAGG + Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1083278903 11:61613500-61613522 CTGTTTATACAGATGTGAGGTGG + Intergenic
1084059429 11:66660607-66660629 CTGGGATTACAGGTGTAGGTAGG + Intronic
1085770307 11:79319736-79319758 CTGTGTTGAAAGATGCAAGTGGG + Intronic
1087234170 11:95699793-95699815 CTTTTTTTATAGGTGTAAGTGGG - Intergenic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1088633936 11:111800956-111800978 ATTTGTTTAGAAATGTAAGTAGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090401333 11:126450139-126450161 ATGTGTATACACATGTATGTGGG + Intronic
1091153106 11:133347570-133347592 CAGAGTTTACAGATTTAGGTTGG + Intronic
1091657652 12:2357281-2357303 CTCTGTTTCCTGATGAAAGTAGG + Intronic
1091692671 12:2607591-2607613 CTGTATTTACAGTGGAAAGTAGG + Intronic
1092615091 12:10209876-10209898 CTGGGATTACAGATGTAATCCGG - Intergenic
1093979624 12:25461625-25461647 CTGTGTTTTCAGCTCTAATTTGG - Intronic
1095188422 12:39228502-39228524 CTCTGTGTACAGATGTACCTGGG - Intergenic
1095903962 12:47358234-47358256 ATGTGTGTACAGATGTGACTAGG + Intergenic
1096223186 12:49845292-49845314 CTGTCTTTATATTTGTAAGTTGG - Intergenic
1099698198 12:86048226-86048248 CCGTGTTTTCAGTTATAAGTGGG + Intronic
1099721459 12:86366486-86366508 CTATGTTCTCAGTTGTAAGTGGG + Intronic
1099893873 12:88620980-88621002 CTGTTTTTTCATATGTTAGTTGG + Intergenic
1101675670 12:106914237-106914259 CAGTGTTTGCAGCTGTAAGCAGG - Intergenic
1102057243 12:109905837-109905859 CTATGTTCACAGCTGTAAGTTGG + Intronic
1102688600 12:114743163-114743185 CTGAGTTTACAGATTTGAGATGG + Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1103379699 12:120484331-120484353 GTGTGTATACAGATGTGGGTGGG + Intronic
1104645929 12:130497187-130497209 GTGTGTTTGGAGATGTAACTAGG - Intronic
1107313580 13:39106406-39106428 CTGTGTGTACAGTTGTCAGCAGG + Intergenic
1109431703 13:62245114-62245136 CAGTTTTTAAAGAAGTAAGTAGG - Intergenic
1109978510 13:69873238-69873260 ATGTGTTTGCAGATGTTACTAGG - Intronic
1111324708 13:86678631-86678653 TTGTCTTTGCAGATGTAATTAGG - Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1113181936 13:107638884-107638906 GTGACTTCACAGATGTAAGTGGG + Intronic
1113684715 13:112274951-112274973 GTGTGTTTTCAGTTGTATGTGGG + Intergenic
1116015285 14:39399472-39399494 CTGTGGTTACATATGCAAGTAGG - Exonic
1116143351 14:41030614-41030636 CATTGTTTACAGATATAGGTTGG - Intergenic
1116402250 14:44522199-44522221 GGGTCTTTACAGATGTAATTAGG + Intergenic
1118214575 14:63796755-63796777 CTATGATTACAGCTGTAAATTGG + Intergenic
1119331448 14:73797347-73797369 CTGTGTGTACAGATGTCACCTGG + Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120670231 14:87354555-87354577 CTATATTTAAAAATGTAAGTAGG + Intergenic
1120766120 14:88327505-88327527 GTGTTTTTGCAGATGTCAGTTGG - Intergenic
1120842283 14:89096492-89096514 ATGTGTGTACATATGTATGTAGG + Intergenic
1121030141 14:90651679-90651701 ATCTGTTTGCAGATGTCAGTTGG + Intronic
1121032586 14:90671929-90671951 CTGTGCTCACAGGGGTAAGTGGG - Intronic
1121972666 14:98372866-98372888 CTGTGTTTTCAGCTTTGAGTTGG - Intergenic
1122239616 14:100353924-100353946 CTGTGTTTTCAGATGCACGATGG - Intronic
1123911861 15:24976150-24976172 CTGTGTTTACAGATATTTTTTGG + Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1124672042 15:31649225-31649247 CTGTGTTACCAGATCAAAGTTGG - Intronic
1129361153 15:75025180-75025202 CTGGGATTACAGGTGTAAGCTGG + Intronic
1130174029 15:81548718-81548740 CCTAGTTTACAGATGTAAATGGG - Intergenic
1131784799 15:95900659-95900681 CTGTGTATAAAGCTGTGAGTTGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133821228 16:9238313-9238335 CTGTGTCTCCAGCTTTAAGTTGG + Intergenic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1135090903 16:19515958-19515980 GGGTGTTTACCGCTGTAAGTGGG + Intronic
1135533757 16:23276774-23276796 CTGGGATTACAGATGTAAGCTGG + Intergenic
1136610285 16:31361896-31361918 CTGTGTTCACACCTGTGAGTGGG + Exonic
1141873839 16:86807776-86807798 CTGTGTCTACAGATGTCACTAGG + Intergenic
1146978685 17:37139224-37139246 CCGTGTGTACAGAGCTAAGTGGG + Intronic
1147901892 17:43792262-43792284 CTGTGTCTACAGCTGTTTGTTGG - Intergenic
1151913014 17:77096679-77096701 CTGTGTTCTCTGATGTAACTTGG + Intronic
1152399803 17:80059095-80059117 CGATGTTTGCAGATGTAAGCTGG - Intronic
1153151785 18:2104458-2104480 ATGTGTTAACAGAGGTGAGTAGG + Intergenic
1155336720 18:24772510-24772532 CTGTGTTTTCAGTTGTATGCAGG - Intergenic
1157339312 18:46765220-46765242 CTGTTTTCACACTTGTAAGTTGG - Intergenic
1158185036 18:54761908-54761930 AAGTCTTTACAGATGTAATTAGG + Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1159304826 18:66627145-66627167 GTGTGTTCTCACATGTAAGTGGG + Intergenic
1160415938 18:78710910-78710932 CTGTGTTTACATATTTGATTTGG - Intergenic
1163247110 19:16103420-16103442 CTGGGATTACAGGTGTAATTTGG - Intergenic
1164274999 19:23708814-23708836 CTCTGCATAAAGATGTAAGTTGG - Intergenic
1167300419 19:48674407-48674429 CGGGGATTGCAGATGTAAGTGGG + Intergenic
927326818 2:21814568-21814590 CTATGTTTGCAGTTGTAAGTTGG - Intergenic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
930103519 2:47620868-47620890 CTGTGTTTTCATCTGTAAGAAGG - Intergenic
931118466 2:59190286-59190308 CTGTGTGTACATATGTTTGTTGG - Intergenic
932589541 2:73056193-73056215 ATGTATTTACAAATGTATGTAGG - Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
937690339 2:124748348-124748370 TTGATTTTACAGAAGTAAGTTGG - Intronic
939993624 2:148899873-148899895 CTGTGTTCACAGCTGAATGTAGG + Intronic
941540443 2:166776338-166776360 CTTTGTTTGCAGTTGTAAGCTGG + Intergenic
941734237 2:168955662-168955684 CTGTGTTTTGAAATGTAAGAAGG - Intronic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
945180949 2:207090558-207090580 CTGTGTTCACAGAGGTTACTAGG + Intronic
946637141 2:221742009-221742031 CAGTGTTTACCCATGTAATTTGG - Intergenic
948180403 2:235975137-235975159 TGGTGTTTAAAGTTGTAAGTAGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170108628 20:12780326-12780348 ATGTTTTTATAGTTGTAAGTTGG - Intergenic
1170576408 20:17665092-17665114 CTGTGTATACATATATATGTGGG + Intronic
1171384661 20:24762428-24762450 CTGTGAGTGAAGATGTAAGTTGG - Intergenic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1178440490 21:32594232-32594254 CTGTGTGTAATGATGTCAGTTGG + Intronic
1179556514 21:42181763-42181785 CTGTTTTTAAAGAACTAAGTTGG + Intergenic
1181724297 22:24800877-24800899 CTGTGTTCTCACTTGTAAGTGGG - Intergenic
1183192400 22:36330179-36330201 CTGTGTTGACAGTGGTAAATTGG - Intronic
1184560747 22:45261636-45261658 GTGCGTGTACAGATGTAAGCGGG + Intergenic
949549302 3:5099018-5099040 ATGTGTTCTCAGTTGTAAGTGGG - Intergenic
951998098 3:28754222-28754244 CTGTGTTTTCACTTATAAGTGGG + Intergenic
952003389 3:28811155-28811177 CTGTGCCCACAGATCTAAGTGGG - Intergenic
958610139 3:96414658-96414680 ATGTGTTTTCACTTGTAAGTGGG - Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959212524 3:103405305-103405327 CTGGGATTACAGATGTCAGCTGG + Intergenic
962810261 3:138953356-138953378 CTGTGTTTTCATTTATAAGTGGG - Exonic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963691634 3:148511109-148511131 CACTGTATACAGATGTAAATTGG + Intergenic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964445120 3:156750496-156750518 CTGGCTGTACAGATGTGAGTAGG + Intergenic
964534203 3:157701676-157701698 CTGTGTTTACAAAGGTAATTAGG - Intergenic
964586107 3:158303965-158303987 AAGTGTTTACAGCTTTAAGTGGG + Intronic
965028285 3:163330123-163330145 CTGTGTTGACAGTTTTAAGCAGG + Intergenic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
965601484 3:170458824-170458846 CTCTGTTTCCAGAAGTAATTTGG + Intronic
967654399 3:192029470-192029492 CTGTGTTTTTATATGTAAGGTGG - Intergenic
969948389 4:10807886-10807908 CTGTCTTGACAGTTGTAAGATGG + Intergenic
970521383 4:16887904-16887926 TTTTTTTTACAGATGCAAGTGGG - Intronic
971404298 4:26307134-26307156 CTGTTTTTACAGATGTGCCTCGG - Intronic
972027682 4:34406007-34406029 CTGTGTGCACAGATATATGTGGG + Intergenic
972223399 4:36983115-36983137 GTGTCTTTGCAGATGTAATTAGG - Intergenic
972872507 4:43317308-43317330 CTGTTTTTACAAGTGGAAGTTGG + Intergenic
973975709 4:56260348-56260370 GTGTGATTTCAGATGTAGGTGGG + Intronic
975385327 4:73751567-73751589 AGGTGTTTCCAGATGGAAGTGGG + Intergenic
975811428 4:78174187-78174209 CTGTGTTTACTGCTTTAACTTGG + Intronic
978830722 4:113081224-113081246 CTGAGTTTAAAAATGTAAGGTGG - Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
980292041 4:130856397-130856419 ATGTGTCTACAAATGTAAGCAGG - Intergenic
980576392 4:134687993-134688015 CTGTGGTGTCAGGTGTAAGTGGG + Intergenic
983252840 4:165364327-165364349 AGGTGTTTACTGATGGAAGTTGG + Intronic
983837818 4:172414353-172414375 CTGTGTATACACATATAAGTTGG - Intronic
984383420 4:179025266-179025288 CTGTCCTTACATATTTAAGTGGG + Intergenic
984546313 4:181108368-181108390 CTGTGTTTTCACATGTCAGAAGG + Intergenic
984870940 4:184324587-184324609 CTGGGATTACAGGTGTGAGTGGG - Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
990131693 5:52594466-52594488 CTGTGTTGACTGAGGTCAGTTGG - Intergenic
990484479 5:56244272-56244294 GTGTGTTTTCAGTTGTATGTGGG + Intergenic
992599410 5:78383128-78383150 CTGTTTTTGCAGGAGTAAGTTGG + Intronic
994213367 5:97109816-97109838 TTGTGTTTTCACATATAAGTGGG - Intronic
995637043 5:114204777-114204799 CTGATTTTAGACATGTAAGTTGG + Intergenic
996029826 5:118692821-118692843 CTGTGATTCCAAATGTCAGTGGG - Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998716879 5:144894086-144894108 CTGTGTGTTCATATGTCAGTGGG + Intergenic
999464382 5:151788180-151788202 CTGGGATTACAGGTGTAATTGGG + Intronic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1003722412 6:8718415-8718437 CTGTTTTTACACCTGTAAATGGG + Intergenic
1006033449 6:31194419-31194441 CTATGTTTTGAGGTGTAAGTAGG - Intergenic
1008342378 6:50383142-50383164 CTGTGTGTACAGGTGTCACTTGG + Intergenic
1008513632 6:52299501-52299523 CTGTGCTTACAGCTGTGGGTGGG + Intergenic
1009456910 6:63868029-63868051 ATGTGTTTTCAGATATATGTTGG - Intronic
1009812766 6:68690030-68690052 CTGTGGTTATAGGTGTAAGTGGG + Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1011589591 6:88959125-88959147 CTGTGTTCTCACTTGTAAGTGGG + Intronic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1015567356 6:134587289-134587311 TTGGGTTTACAGCAGTAAGTTGG + Intergenic
1017046173 6:150349026-150349048 GTGTCATTACAGATGTAACTAGG - Intergenic
1018013222 6:159690536-159690558 CTGTGTATTCAGATATCAGTTGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1019230205 6:170554236-170554258 CTGTGTTTCCATAGGTAAGGAGG - Intergenic
1019598165 7:1868054-1868076 CAGTGCTTACAGAGGTCAGTAGG - Intronic
1021174439 7:17434854-17434876 GCGTGTCTACAGATGTATGTTGG + Intergenic
1021269298 7:18565478-18565500 CTGTGTTTACCATTGTTAGTTGG + Intronic
1021292481 7:18863583-18863605 CTTTGTTCACAGATGTATTTTGG - Intronic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1023775331 7:43600262-43600284 CTGTGTTTTCAGTTGTATGCAGG - Intronic
1024224311 7:47314067-47314089 CTGTGCTCAGAGATGCAAGTCGG + Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1027739541 7:81983128-81983150 CTGTGTTTTCATATGCAAGCTGG - Intronic
1027940179 7:84668417-84668439 CTTTGTTCACATATTTAAGTTGG - Intergenic
1028716078 7:93970710-93970732 ATGTGTTCACAAATGTAATTGGG + Intronic
1029868705 7:103664283-103664305 GTGTGTTTACATATGCATGTGGG + Intronic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1034401093 7:150862035-150862057 CTGTGTTTACAGGTGGATCTTGG - Intergenic
1034592556 7:152154511-152154533 CTGTATTCACAGATGTCAGCAGG - Intronic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1038855396 8:31325547-31325569 CTGGGATTACAGGTGTAAGCTGG + Intergenic
1039245976 8:35608657-35608679 ATGTGTTCTCACATGTAAGTTGG - Intronic
1039698289 8:39936087-39936109 CTGTACTTACTGATGTTAGTAGG - Intronic
1039781122 8:40786807-40786829 CTGTGCTTACAGAAGAAAATTGG + Intronic
1040665193 8:49623338-49623360 CTGTGTTTACAGTTTTATTTGGG + Intergenic
1040689515 8:49918496-49918518 CTGTTTTTACACATATGAGTAGG - Intronic
1041129008 8:54676559-54676581 CATTGTTTACATATGTATGTTGG - Intergenic
1045498336 8:102726914-102726936 CTGTGTTTTCAAATGCAACTTGG - Intergenic
1045955822 8:107905395-107905417 GTGTGTTTATATATGTATGTAGG - Intronic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048423371 8:134299324-134299346 ATGTGGTTACAGATGTCAGATGG + Intergenic
1050493174 9:6211377-6211399 CTGTGTTAACAGGTGTTTGTGGG + Intergenic
1050586602 9:7118870-7118892 CTGTGTTTACATCTGGAAGGAGG - Intergenic
1051754078 9:20376199-20376221 CTGTGGTTACAGACTTGAGTAGG - Intronic
1055629651 9:78210795-78210817 CTGTGTTTACATTTCTTAGTGGG - Intergenic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1057633975 9:96745966-96745988 GGGTGTTTGCAGATGTAATTAGG + Intergenic
1059088292 9:111328594-111328616 GTGTGTTTATTGATGTAAGGGGG + Intergenic
1060646088 9:125281112-125281134 ATGTGTTAACAGATGTTAATGGG + Intronic
1186095202 X:6093164-6093186 CTGGCTATACAGATGTCAGTTGG - Intronic
1187792083 X:22962035-22962057 CTGAAGTTACAGATATAAGTAGG - Intergenic
1189697868 X:43684317-43684339 CTGTGGGTACTGATGAAAGTAGG + Intronic
1192901276 X:75500047-75500069 CTATGTTTTCAGTTATAAGTGGG + Intronic
1193403267 X:81070824-81070846 TTGTGTTCTCACATGTAAGTGGG + Intergenic
1195729343 X:107949885-107949907 CTGAGTTTACAGATTTAACCAGG + Intergenic
1197360551 X:125497342-125497364 AAGTGTTTACTGATTTAAGTAGG + Intergenic
1200340008 X:155386286-155386308 CTGTGTTCTCACCTGTAAGTGGG - Intergenic
1200346462 X:155454402-155454424 CTGTGTTCTCACCTGTAAGTGGG + Intergenic