ID: 915027572

View in Genome Browser
Species Human (GRCh38)
Location 1:152845406-152845428
Sequence ACCCATTGTGTGATGTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915027572_915027574 28 Left 915027572 1:152845406-152845428 CCTTTAAACATCACACAATGGGT 0: 1
1: 0
2: 0
3: 11
4: 136
Right 915027574 1:152845457-152845479 TTTTTTTACTGTTAAGTAAATGG 0: 1
1: 1
2: 5
3: 152
4: 1506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915027572 Original CRISPR ACCCATTGTGTGATGTTTAA AGG (reversed) Intergenic
903553652 1:24177440-24177462 ACCCGGAGTGTGATGTTCAAGGG + Intronic
904452213 1:30621091-30621113 ACGACTTGTGTGATGTTTCATGG - Intergenic
907849263 1:58238617-58238639 AACAAATGTGTGATGTTTAATGG + Intronic
911223823 1:95281569-95281591 ATGGATTGTGTTATGTTTAAAGG + Intergenic
915027572 1:152845406-152845428 ACCCATTGTGTGATGTTTAAAGG - Intergenic
915073536 1:153291694-153291716 ACCCAGTGTGTAATGACTAAGGG - Intergenic
915282302 1:154830823-154830845 TCCCATTGTGTGATGTCCCAAGG + Intronic
916541454 1:165759348-165759370 ACCCATTTTGTGAGGTGTACAGG - Intronic
917972082 1:180215013-180215035 GCCTATTGTGTAATCTTTAAGGG + Intergenic
921697407 1:218227942-218227964 ATTCATTCTGTGGTGTTTAAGGG - Intergenic
1062993864 10:1847073-1847095 ATCCAATGTGTGAAATTTAAAGG + Intergenic
1063704382 10:8416713-8416735 TGTCATTGTGTGATGTTTAATGG + Intergenic
1063908928 10:10810479-10810501 CCCCATTGGGGGATGCTTAAGGG - Intergenic
1065280344 10:24131339-24131361 ACCCATCCTGTGTTATTTAAAGG + Intronic
1066122020 10:32298370-32298392 CCACATTGTGTGCTGTTTCATGG - Intronic
1067669376 10:48305983-48306005 ACCCGTTGTTGGATATTTAAAGG + Intergenic
1069291745 10:66788468-66788490 ACCCATTATTTGATGTTTACAGG - Intronic
1080954606 11:37078709-37078731 ACCCATTGGAAGATGTTTAGAGG - Intergenic
1081080653 11:38735450-38735472 CCCAATTGTCTGATGTATAATGG + Intergenic
1084458563 11:69283639-69283661 TCCCACTGTGAGATGTTTGAGGG + Intergenic
1086263331 11:84967784-84967806 ACTCATTGTGTGATTTTTCCAGG - Intronic
1087122664 11:94590980-94591002 ACCCAGAGTGTCATGTGTAAAGG + Intronic
1087828285 11:102791158-102791180 AGGCATTGTGTGATGATTATTGG + Intronic
1093828016 12:23718989-23719011 ACCCACTCTGAGATTTTTAATGG - Intronic
1095273098 12:40244703-40244725 CCCCAGAGTGTGATGTTCAAGGG - Intronic
1100974408 12:100107377-100107399 GCCCATTTTGAGATTTTTAAGGG - Intronic
1105258331 13:18760052-18760074 CCCAATTGTGTTATTTTTAAGGG - Intergenic
1105614524 13:22000129-22000151 TCCCATTATGTGTTATTTAAAGG - Intergenic
1106823428 13:33491725-33491747 TCACATTGTGTGAGGTTTAATGG - Intergenic
1110009407 13:70313134-70313156 AACCATAGTTTGATGGTTAATGG + Intergenic
1110346001 13:74448697-74448719 TCCCAGTGTGTCATATTTAAAGG + Intergenic
1114083667 14:19221277-19221299 ACCCATTGTGTGGTGATCAGTGG - Intergenic
1116163471 14:41301858-41301880 ATACATTGTGTGTTGTCTAAAGG - Intergenic
1116625726 14:47260533-47260555 ACCCACAGTGTAATTTTTAAAGG + Intronic
1117274921 14:54183393-54183415 ATCCTTTGTGTGATGATTACCGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122210355 14:100169683-100169705 ACCCAGTGTGTGATATTTTAAGG - Intergenic
1126113777 15:45190483-45190505 AATCATTGTGTGAGGATTAAGGG + Intronic
1126983908 15:54280309-54280331 ACCCAATGTGTTAAGTTAAAGGG + Intronic
1127448207 15:59087787-59087809 ACCCATTTTATGTTGTTCAAGGG + Intronic
1127832933 15:62766791-62766813 CCCCATTCTGGTATGTTTAAGGG + Intronic
1128441710 15:67715703-67715725 ACCCATTTTCAGATGTTTGAAGG + Intronic
1128977803 15:72166260-72166282 AAGCATTCTGAGATGTTTAAGGG + Intronic
1129873872 15:78959528-78959550 ACACATTGGTTGATGTATAAAGG - Intergenic
1130395538 15:83497742-83497764 ATCCATTGTGTGATGATGGAGGG - Intronic
1130407904 15:83618713-83618735 ACACAGTGTGTCATGTTTATTGG - Exonic
1131687428 15:94784882-94784904 ACCCATGATGTTATGTTTAGTGG - Intergenic
1133824969 16:9270221-9270243 ACACATTGTTTGATGTGTTAAGG + Intergenic
1134107195 16:11493618-11493640 AGCCCTTGTGTGCTGTTTCATGG - Intronic
1136050227 16:27644994-27645016 GCCCAGGGTGTGATATTTAAGGG - Intronic
1139247230 16:65457004-65457026 CCCCGGTGTGTGATGTTTGAGGG + Intergenic
1141493901 16:84393657-84393679 ACCCATGCTGAGATGTTTATGGG + Intronic
1145358709 17:22191002-22191024 ACACACTGAGTGATATTTAATGG - Intergenic
1149152758 17:53589101-53589123 ACCAATTGTGTGAAATTTTAGGG + Intergenic
1150888446 17:69115164-69115186 TTCCATTGTGTGATATTTCAGGG - Intronic
1153077653 18:1183571-1183593 ACCCATTGTGTGATGGTATTAGG + Intergenic
1153309865 18:3667540-3667562 AAACATTCTGTGATGTTGAAAGG + Intronic
1157149509 18:45202397-45202419 ACCAATTATGTGATGTTCAAAGG + Intergenic
1157529060 18:48407052-48407074 ACCCACTCATTGATGTTTAATGG + Intronic
1159123367 18:64195570-64195592 AGCCAATGTGTGCTGTTGAAGGG - Intergenic
1161255573 19:3307280-3307302 ATGCATTGCGTGATTTTTAAAGG + Intergenic
1168583471 19:57574661-57574683 CCCCATTTTGTGATCTTTAGAGG - Intronic
926331919 2:11832645-11832667 AACCATTGGCTGATGTATAAAGG + Intergenic
929837904 2:45425493-45425515 CCCTACTGTGTGATTTTTAATGG - Intronic
935411253 2:102765880-102765902 AACCTTTGTGTCATGTCTAATGG + Intronic
937861322 2:126713407-126713429 ACCCGCAGTATGATGTTTAATGG - Intergenic
938492915 2:131775356-131775378 ACCCATTGTGTGGTGATCAGTGG + Intergenic
940206383 2:151206875-151206897 CCACATTGTGAGATGTGTAAAGG - Intergenic
947538959 2:230961291-230961313 ACCCAGTGTGTGGTATTTTATGG - Intergenic
1169914248 20:10671768-10671790 ACCCATTTTGGGATGTTGCAAGG + Intronic
1170028225 20:11914194-11914216 ACCCAGTGGGTGATGTTTCTGGG + Intronic
1170055493 20:12198541-12198563 AGCCATTGTGTGCTCTTTATTGG - Intergenic
1170519036 20:17163862-17163884 ACCCATTTTGTTATGATTATGGG - Intergenic
1171481266 20:25457555-25457577 CCCCTTTGTGTGATGTTACAAGG + Intronic
1173484249 20:43428772-43428794 AACCAATGTGTCATGTTTAAGGG - Intergenic
1174684183 20:52437812-52437834 ACACATTGTTAGATGTTTACTGG + Intergenic
1180294308 22:10871990-10872012 ACCCATTGTGTGGTGATCAGTGG + Intergenic
1180497114 22:15901404-15901426 ACCCATTGTGTGGTGATCAGTGG + Intergenic
1181438598 22:22924284-22924306 AGTCAGTGTGTGATGTTTTAAGG - Intergenic
1181550600 22:23637057-23637079 AACCAATGTGTGATGTTTTAGGG + Intergenic
1183860541 22:40666646-40666668 GTCCATTGTGTGGTGTTTTATGG - Intergenic
949493014 3:4607448-4607470 ACCCATTGGGTGGTTTATAAGGG - Intronic
953910072 3:46888239-46888261 ACCCATAGAATGATGGTTAATGG - Intronic
955813307 3:62815334-62815356 AATCATTGTGTGATGTCTAGGGG - Intronic
956296092 3:67715280-67715302 ACCCAATGTCTGCTGCTTAAGGG + Intergenic
956421990 3:69095080-69095102 ACCCATTCTGTCATGTTAACCGG - Intronic
957176733 3:76820548-76820570 TTCCATTTTTTGATGTTTAAAGG - Intronic
959384089 3:105679951-105679973 GCCCAGTGTCAGATGTTTAAGGG - Intronic
961016679 3:123473857-123473879 ACCCATTGACTGATGTTTGAAGG + Intergenic
964674464 3:159262133-159262155 ACTCAATGTGTGATTTTTGAGGG - Intronic
965330734 3:167371452-167371474 AAGCATGGTGTGATGTGTAAAGG - Intronic
966143224 3:176780319-176780341 TCCCATTGTGTGTTGATTCAGGG - Intergenic
970278457 4:14427199-14427221 ATCCTTTGTGTGGTGTTTTATGG - Intergenic
970936276 4:21573971-21573993 ACCCATTTTGAAATTTTTAAAGG - Intronic
972159190 4:36201907-36201929 TCCAATTGTGTGATTTTTAAAGG - Intronic
973025155 4:45259854-45259876 ACCCACTTTTTGATGTTTGATGG + Intergenic
976713131 4:88094517-88094539 TACCATGGTGTGATGTATAAAGG - Intronic
977488722 4:97684034-97684056 ACCTATTTTGTCAAGTTTAAAGG - Intronic
977513109 4:97986804-97986826 ACACATTCAATGATGTTTAAAGG - Intronic
978542849 4:109837529-109837551 ACTGGTAGTGTGATGTTTAATGG - Exonic
980175337 4:129337816-129337838 ACCCCTTCTGTGATGTCAAAAGG - Intergenic
982270144 4:153578012-153578034 ACTCAGTGTCTGATGGTTAAAGG + Intronic
984351148 4:178595372-178595394 CCCCAGAGTGTGATGTTCAAAGG + Intergenic
986031318 5:3895283-3895305 CCCCAGTGTGTGATGTTCATGGG + Intergenic
986739613 5:10694615-10694637 ACCCACTGTGTGCTGATGAAAGG + Intronic
986981055 5:13448415-13448437 ACTCAGTGTCTGATGTTCAAGGG + Intergenic
987477161 5:18405000-18405022 TCCCAGTGTATGTTGTTTAAGGG - Intergenic
989212759 5:38872786-38872808 CCCCATTTTATGATTTTTAAAGG - Intronic
990167335 5:53009222-53009244 ACCCATTGTATTAAGTTGAATGG + Intronic
992133164 5:73715472-73715494 ACCCATTGTGTGAGTTTCAGTGG - Intronic
992395440 5:76365155-76365177 ACCAATTGTCTTATTTTTAATGG + Intergenic
994580523 5:101635545-101635567 ACTCATTGTGTGATGTATTTTGG + Intergenic
995597416 5:113762942-113762964 ACCCAGTTTGTGATTTGTAATGG + Intergenic
1001753458 5:174148518-174148540 ATCCAATGTGTGATTTATAAAGG - Intronic
1004235709 6:13873063-13873085 ATCCAATATGTGATGTCTAATGG + Intergenic
1005497212 6:26398197-26398219 ACTCATTGTGAGATGTCTAGTGG - Intergenic
1010114334 6:72284210-72284232 ACACAAATTGTGATGTTTAAAGG + Intronic
1012565777 6:100648615-100648637 ACCCATTCAGTCATTTTTAATGG - Intronic
1013933942 6:115570904-115570926 AAACATTATGTTATGTTTAATGG - Intergenic
1014487723 6:122021036-122021058 ACCCAGTGTCTGATATATAAGGG + Intergenic
1015485106 6:133760908-133760930 AGCCATTATTTGTTGTTTAATGG + Intergenic
1016192343 6:141286219-141286241 AGTCATTGTGTGGTGTTGAAGGG - Intergenic
1017972200 6:159322557-159322579 CACCATGATGTGATGTTTAAGGG + Intergenic
1018108743 6:160514131-160514153 ACCCATTGTGTGTTGTATTCAGG + Intergenic
1019073821 6:169370864-169370886 ATGCAATGTGTGATGTCTAAGGG - Intergenic
1021601519 7:22368909-22368931 ACCAATCATGAGATGTTTAATGG + Intergenic
1026423880 7:70270202-70270224 ATCTATTGTGTTATGTTTACTGG + Intronic
1027901694 7:84124255-84124277 ACCCAGTGTGACTTGTTTAAAGG + Intronic
1030847816 7:114443087-114443109 GCACATTGTGTGATCATTAAAGG + Intronic
1032477145 7:132219480-132219502 AGGCATTGTGAGAGGTTTAAAGG - Intronic
1037969995 8:23164904-23164926 ACCCAATGTGTGGTTTTGAAGGG + Intergenic
1041878749 8:62721780-62721802 ACTCCTTGTGTGTTATTTAAAGG + Intronic
1042952386 8:74214460-74214482 ACCAGTTGTGTGCTGGTTAAAGG + Intergenic
1044200872 8:89434338-89434360 ACCAATTTTGTCATTTTTAAAGG + Intergenic
1044266253 8:90185314-90185336 ACGCCTTTTGTGATGTTTAGGGG - Intergenic
1044777896 8:95712867-95712889 CTTCATTGTGTGATTTTTAATGG - Intergenic
1046009381 8:108527885-108527907 CCCCAGTGTGTGATGTTCAAGGG + Intergenic
1046961369 8:120116589-120116611 ATCCATTTTGTGTTTTTTAAAGG - Intronic
1047862576 8:128984605-128984627 CCCCATTGTGTGTTTTTTTATGG + Intergenic
1047987202 8:130247483-130247505 CCCCATTGTGTCAGGTTGAAGGG - Intronic
1057128041 9:92634575-92634597 ACAAAATGTGTGATGTTTAGTGG - Intronic
1060335779 9:122720515-122720537 CCCCAGAGTGTGATGTTAAAAGG + Intergenic
1061351083 9:130065463-130065485 ACCCATTAAGTGATGTTTGTAGG + Intronic
1192434365 X:71133800-71133822 ACCCACTGTGGAATGTTGAATGG + Intronic
1193443771 X:81574937-81574959 AACCCTTGTGTGCTGTTTCAGGG + Intergenic
1197054868 X:122105488-122105510 AACCAATGTGCTATGTTTAAAGG - Intergenic
1197324796 X:125079692-125079714 TCCCATTATGTGATTTTTCATGG + Intergenic
1198069537 X:133134449-133134471 GCCCACTGAGTGATGTTTCAAGG - Intergenic