ID: 915031879

View in Genome Browser
Species Human (GRCh38)
Location 1:152886787-152886809
Sequence GCTTCCACCGATGAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915031879_915031888 20 Left 915031879 1:152886787-152886809 CCCCCCAACTCATCGGTGGAAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 915031888 1:152886830-152886852 TGGGCCTCACCACCATCCCCAGG 0: 1
1: 0
2: 1
3: 38
4: 354
915031879_915031891 30 Left 915031879 1:152886787-152886809 CCCCCCAACTCATCGGTGGAAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 915031891 1:152886840-152886862 CACCATCCCCAGGCCCAATGCGG 0: 1
1: 0
2: 5
3: 29
4: 306
915031879_915031885 0 Left 915031879 1:152886787-152886809 CCCCCCAACTCATCGGTGGAAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 915031885 1:152886810-152886832 CAGTGAGAGTCCTGCTACACTGG 0: 1
1: 0
2: 0
3: 9
4: 101
915031879_915031886 1 Left 915031879 1:152886787-152886809 CCCCCCAACTCATCGGTGGAAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 915031886 1:152886811-152886833 AGTGAGAGTCCTGCTACACTGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915031879 Original CRISPR GCTTCCACCGATGAGTTGGG GGG (reversed) Intergenic
901856652 1:12048765-12048787 GCTTCAACCTATGAATTTGGGGG - Intergenic
901876098 1:12167751-12167773 GCTTCCTCCGATGCGTCCGGGGG + Intronic
901915800 1:12498930-12498952 GCTTCCACATATGAATTGGCGGG + Intronic
907289618 1:53404853-53404875 GCTTCAACATATGAGTGGGGAGG + Intergenic
908930995 1:69315740-69315762 TCTTCCACTGCTGAGGTGGGTGG + Intergenic
910607191 1:89100012-89100034 GCTTCAACAGTTGAGTTTGGGGG - Intergenic
913112590 1:115669950-115669972 GCTTCCACATATGAATTTGGGGG - Intronic
915031879 1:152886787-152886809 GCTTCCACCGATGAGTTGGGGGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920159910 1:203988730-203988752 GCTTCGACGTATGAGTTGTGGGG - Intergenic
921119949 1:212127516-212127538 GCTTCCACAGAAGAGCTGAGCGG + Intergenic
921217838 1:212951826-212951848 GCTTCCAGGGCGGAGTTGGGGGG + Intronic
921922487 1:220685314-220685336 GTTTCAACCTATGAATTGGGAGG - Intergenic
922672686 1:227523680-227523702 GCTTCCACTGTGGAGTTGGGAGG - Intergenic
1062761599 10:26607-26629 GTTTCCACCGTGGAGTTGGGAGG + Intergenic
1064314809 10:14245522-14245544 ACTTCAACAGATGAGTTTGGGGG - Intronic
1067735533 10:48847365-48847387 GCTTCAACATATGAATTGGGGGG + Intronic
1074752156 10:116597014-116597036 TCTCCCACTGATGAGTTGTGTGG - Intronic
1079501371 11:21105044-21105066 GCTTCCACATATGAATTTGGGGG + Intronic
1082701194 11:56433252-56433274 TCCTCCACCCCTGAGTTGGGTGG + Intergenic
1083396326 11:62395196-62395218 GCTTCCACTGTTGATCTGGGTGG - Intergenic
1087675249 11:101154254-101154276 GCTTCAACATATGAATTGGGTGG - Intergenic
1087990700 11:104743334-104743356 GTTTCCACTGAGGAGTTTGGGGG + Intergenic
1091187574 11:133660010-133660032 GCTTACACCGATGGGAGGGGTGG + Intergenic
1091541487 12:1466445-1466467 GCTTCCACCTATGAATTTGGTGG + Intronic
1091667088 12:2427052-2427074 TCTTCCACAGATGGGTTGGTTGG + Intronic
1092282456 12:7108472-7108494 GCCACCACCTGTGAGTTGGGGGG + Exonic
1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG + Intronic
1094811367 12:34141553-34141575 GTTTCCACCATGGAGTTGGGAGG + Intergenic
1095847368 12:46760073-46760095 GCTTCCACATATGAATTTGGGGG + Intergenic
1097642696 12:62201748-62201770 GCCTCAAAAGATGAGTTGGGAGG + Intronic
1103833959 12:123804133-123804155 GCTTTCGCAGATGAGGTGGGAGG - Intronic
1105973641 13:25453951-25453973 GGTTTCACTGATGAGTGGGGAGG + Intronic
1109480019 13:62939796-62939818 GCTTCCACATATGAGTGAGGAGG - Intergenic
1109535992 13:63720331-63720353 GCTTCAACATATGAGTTTGGGGG + Intergenic
1109540108 13:63765955-63765977 GCTTCAACATATGAGTTTGGGGG - Intergenic
1111151972 13:84264669-84264691 GCTTCAACCTATGAATTTGGAGG - Intergenic
1113538977 13:111092165-111092187 GCTTCAACCTATGAATTAGGGGG - Intergenic
1119112546 14:71988572-71988594 GCTACCACGGAGGAGTTGAGTGG + Intronic
1120924340 14:89782786-89782808 TTTTCCACAGATGAGATGGGGGG + Intergenic
1121646775 14:95523703-95523725 GCTTCCATCGATGGGGTGGGTGG + Intergenic
1122387332 14:101358093-101358115 GCATCCACCGAGCAGCTGGGAGG + Intergenic
1125002381 15:34785005-34785027 TCTGCCACTGATGAGTTGAGTGG - Intergenic
1126921099 15:53525719-53525741 GCTTCCACCTCTGATTTTGGAGG + Intronic
1127719389 15:61684794-61684816 GCTTCAACCTATGAATTTGGGGG + Intergenic
1129192652 15:73946545-73946567 GCTGCCACCAGTGAGTGGGGAGG + Exonic
1130536144 15:84786379-84786401 GCTTGCAAGGATGAGTTTGGAGG + Intronic
1130983263 15:88827454-88827476 GCTAGCACCCATTAGTTGGGTGG + Intronic
1130983276 15:88827576-88827598 GCTAGCACCCATTAGTTGGGTGG + Intronic
1131036544 15:89226173-89226195 GCTTCCACATATGGATTGGGTGG - Intergenic
1132473909 16:122865-122887 GCTTCCAGCAAGGAGGTGGGTGG - Intronic
1133643252 16:7738306-7738328 GCTTCAACACATGAGTTGGAAGG + Intergenic
1133857591 16:9564335-9564357 GCTTCCACAGACGATTTCGGTGG + Intergenic
1134230536 16:12425709-12425731 GTTTGCACAGATGATTTGGGCGG + Intronic
1142184369 16:88687407-88687429 GCTTCCACCTCAGAGCTGGGTGG + Intergenic
1143978527 17:10847774-10847796 GCTTCAACCTATGAATTTGGGGG - Intergenic
1144010278 17:11141625-11141647 GCTTCAACATATGAGTTTGGGGG + Intergenic
1148923337 17:51060144-51060166 GCTTCAACCTATGAATTTGGGGG - Intronic
1152954506 18:26937-26959 GTTTCCACCGTGGAGTTGGGAGG + Intergenic
1153609292 18:6866498-6866520 GTTTCCACTGATGAGGTGGTTGG - Intronic
1153808001 18:8726650-8726672 GCTTCCACATATGAATTTGGGGG + Intronic
1157375626 18:47161690-47161712 TTTTCCACAGATGGGTTGGGGGG + Intronic
1157946992 18:51991520-51991542 GCTTCCACAGATGAATTTGAAGG + Intergenic
1160418652 18:78729025-78729047 GCGTCCACTGCTGAGTGGGGGGG + Intergenic
1161009631 19:1954055-1954077 GCTTCCTCCCATGGGGTGGGCGG + Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161740434 19:6017925-6017947 GCTTCTAATGCTGAGTTGGGGGG - Intronic
1164502538 19:28831815-28831837 ACTTCCACAGATGAATTTGGGGG + Intergenic
1166036492 19:40171911-40171933 GCTTCCACATATGAATTTGGGGG + Intergenic
1167201406 19:48067945-48067967 GCTTCCACATATGACTTTGGTGG - Intronic
1168404901 19:56105598-56105620 GCTTCCCCCGAGAAGCTGGGTGG - Intronic
926963472 2:18385192-18385214 GCTTCCACAGATGAAGTTGGTGG - Intergenic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
935154221 2:100468253-100468275 GCTTCAACCTATGAATTGTGGGG + Intergenic
938373539 2:130789320-130789342 GCTTCCACCTATGATTTTGGGGG - Intergenic
944402899 2:199348795-199348817 ACTTCCACGGAAGAGTTGGTTGG + Exonic
947836814 2:233181737-233181759 TCTCCCACCGATGAGCTGAGTGG + Intronic
948253474 2:236549700-236549722 CCTTTCACCCATGGGTTGGGTGG - Intergenic
1171981562 20:31632730-31632752 GCTCCCACAGGTGAGCTGGGTGG + Intergenic
1172385290 20:34529906-34529928 GCTGCCCCTGATCAGTTGGGTGG + Intronic
1174270570 20:49365342-49365364 GCCTCCAGTGAGGAGTTGGGAGG + Exonic
1174820090 20:53719170-53719192 GCTTCAACATATGAATTGGGAGG - Intergenic
1175091735 20:56510573-56510595 TCTGCCCCCTATGAGTTGGGTGG - Intronic
1177103350 21:16922722-16922744 GCTTCAACCCATGAATTTGGGGG - Intergenic
1179145013 21:38760464-38760486 GCTTCAACAGATGAGCTTGGGGG - Intergenic
1180707828 22:17820047-17820069 GCTTGAGCCGAGGAGTTGGGAGG + Intronic
1182747210 22:32615189-32615211 GGATCCACCGCTGAGGTGGGTGG + Intronic
1182842307 22:33401224-33401246 GCTTCAACAGATGAATTTGGAGG - Intronic
1183063342 22:35348477-35348499 GCTTCCTCCTCTGAGCTGGGCGG - Intergenic
1185152967 22:49176930-49176952 ACTTCCACCGTTGAGTTGATCGG + Intergenic
955989533 3:64611558-64611580 TCTTCCACAGATGGGGTGGGTGG + Intronic
956520849 3:70102562-70102584 TCTTTCACCAATGAGCTGGGTGG + Intergenic
961359672 3:126358947-126358969 GCTTTCACCAAGGAGATGGGAGG - Intergenic
961476888 3:127152600-127152622 GCTTCCACATATGAATTAGGGGG + Intergenic
968551471 4:1225851-1225873 GCTGCCAGCGCTGAGTCGGGAGG - Intronic
973193656 4:47415246-47415268 GCTTCCACCTTTCAGTTGTGTGG - Intronic
976221963 4:82763138-82763160 GCTTCAGCATATGAGTTGGGTGG - Intronic
976398954 4:84586216-84586238 TTTTCCACGGATGGGTTGGGGGG + Intronic
982736669 4:159013695-159013717 GCTTCAACATATGAATTGGGGGG + Intronic
991918007 5:71624261-71624283 GCTTCAGCAGATGAGTTCGGAGG + Intronic
993708369 5:91196894-91196916 GCTTCAACAGATGAATTTGGGGG - Intergenic
994112340 5:96020837-96020859 TTTTCCACAGATGGGTTGGGGGG - Intergenic
1002302823 5:178267153-178267175 GCTTCCACCGGTGCTATGGGTGG + Intronic
1005992737 6:30913717-30913739 GCTGCCACCAAGGAGCTGGGGGG + Intronic
1013799265 6:113922154-113922176 GTTTCCATGGATGAGATGGGAGG + Intergenic
1014826811 6:126056363-126056385 GCTTCCACTGCTGAGATGTGGGG + Intergenic
1018406789 6:163493618-163493640 GATTCCACCACTGAGGTGGGAGG + Intronic
1019326471 7:440874-440896 GCTTCCACCTATAAGTTTGGAGG + Intergenic
1021206184 7:17784146-17784168 GCTCCCACATATGAGTTGGGAGG + Intergenic
1022566153 7:31404545-31404567 GCTTCAACAGATGATTTGGGGGG - Intergenic
1022968115 7:35493078-35493100 GCTTCCACCAATGCTTGGGGCGG + Intergenic
1024940899 7:54761902-54761924 GCTTCCACATATGAATTTGGAGG + Intergenic
1033773535 7:144581005-144581027 GTTTCAACAGATGAATTGGGAGG - Intronic
1037053571 8:14407425-14407447 TCATCCACCTATGTGTTGGGTGG + Intronic
1037125007 8:15337606-15337628 GCTTCCACATATGAATTGTGGGG + Intergenic
1038258517 8:25972444-25972466 GCTTCCACTGATGACAGGGGAGG - Intronic
1042184426 8:66122626-66122648 GCATCCATCAGTGAGTTGGGGGG - Intergenic
1047000004 8:120564169-120564191 GCTTCAACACATGAATTGGGTGG - Intronic
1049882569 8:145076363-145076385 GTTTCCACTGTGGAGTTGGGAGG - Intergenic
1055773754 9:79745568-79745590 GTCTCCACGGATGAGTTTGGGGG - Intergenic
1056395244 9:86175734-86175756 GCACCCACCGATGAGTTGCATGG - Intergenic
1056986909 9:91371807-91371829 GCTTCCACATATGAATTGGAGGG + Intergenic
1060167836 9:121434184-121434206 GCTTCCAGTGATGAGTTGCATGG - Intergenic
1062743838 9:138198334-138198356 GTTTCCACCGTGGAGTTGGGAGG - Intergenic
1188057713 X:25560871-25560893 GCTTCCACATATGAGTTATGGGG + Intergenic
1196442169 X:115727772-115727794 GCACCGACCGATGAGTTCGGTGG - Intergenic
1196442829 X:115730726-115730748 GCACCGACCGATGAGTTCGGTGG - Intergenic
1196443393 X:115733142-115733164 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196444129 X:115736795-115736817 GCACCGACCGATGAGTTCGGTGG - Intergenic
1196445717 X:115845062-115845084 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196446388 X:115848043-115848065 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196447059 X:115851024-115851046 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196447728 X:115854007-115854029 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196448398 X:115856986-115857008 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196449067 X:115859977-115859999 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196449738 X:115862968-115862990 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196450407 X:115865951-115865973 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196451077 X:115868936-115868958 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196451748 X:115871915-115871937 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196452419 X:115874902-115874924 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196453089 X:115877871-115877893 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196453759 X:115880864-115880886 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196454428 X:115883873-115883895 GCACCGACCGATGAGTTCGGTGG + Intergenic
1196455503 X:115888935-115888957 GCACCGACCGATGAGTTCGGTGG + Intergenic
1198513260 X:137375586-137375608 GCTTCCACCTACCAGTTGTGTGG + Intergenic
1198870302 X:141171822-141171844 TGTTCCATGGATGAGTTGGGAGG - Intergenic