ID: 915032659

View in Genome Browser
Species Human (GRCh38)
Location 1:152896844-152896866
Sequence CTGCATGTAGGGATGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915032659_915032668 23 Left 915032659 1:152896844-152896866 CCTTGCCTCATCCCTACATGCAG No data
Right 915032668 1:152896890-152896912 TGGCCAGTTAGCCAGTTGCTCGG No data
915032659_915032664 3 Left 915032659 1:152896844-152896866 CCTTGCCTCATCCCTACATGCAG No data
Right 915032664 1:152896870-152896892 TCCCATTCTGTTTGGCCTCATGG No data
915032659_915032663 -5 Left 915032659 1:152896844-152896866 CCTTGCCTCATCCCTACATGCAG No data
Right 915032663 1:152896862-152896884 TGCAGACTTCCCATTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915032659 Original CRISPR CTGCATGTAGGGATGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr