ID: 915038041

View in Genome Browser
Species Human (GRCh38)
Location 1:152945001-152945023
Sequence AAATCAAACCCACATGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915038041_915038044 25 Left 915038041 1:152945001-152945023 CCAGTGACATGTGGGTTTGATTT No data
Right 915038044 1:152945049-152945071 TGAAAAGTATCTGTAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915038041 Original CRISPR AAATCAAACCCACATGTCAC TGG (reversed) Intergenic