ID: 915038396

View in Genome Browser
Species Human (GRCh38)
Location 1:152947445-152947467
Sequence CTGAGCAGGGAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915038386_915038396 3 Left 915038386 1:152947419-152947441 CCAGCAGAGTAGTGTGGGAGGCT No data
Right 915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG No data
915038382_915038396 15 Left 915038382 1:152947407-152947429 CCAGCAAGTTATCCAGCAGAGTA No data
Right 915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG No data
915038381_915038396 27 Left 915038381 1:152947395-152947417 CCTATCTTGGGTCCAGCAAGTTA No data
Right 915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915038396 Original CRISPR CTGAGCAGGGAGAAGGAGGG GGG Intergenic
No off target data available for this crispr