ID: 915039017

View in Genome Browser
Species Human (GRCh38)
Location 1:152952198-152952220
Sequence GGTTATCTCAGAAGCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915039017_915039025 15 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data
915039017_915039022 3 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039022 1:152952224-152952246 CATTTACAAGGCTCCTACCAGGG No data
915039017_915039027 16 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039027 1:152952237-152952259 CCTACCAGGGTAAGATGTGGGGG No data
915039017_915039021 2 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039021 1:152952223-152952245 ACATTTACAAGGCTCCTACCAGG No data
915039017_915039023 13 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039023 1:152952234-152952256 GCTCCTACCAGGGTAAGATGTGG No data
915039017_915039024 14 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039024 1:152952235-152952257 CTCCTACCAGGGTAAGATGTGGG No data
915039017_915039019 -9 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039019 1:152952212-152952234 GAGATAACCAGACATTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915039017 Original CRISPR GGTTATCTCAGAAGCCTCCA GGG (reversed) Intergenic
No off target data available for this crispr