ID: 915039018

View in Genome Browser
Species Human (GRCh38)
Location 1:152952199-152952221
Sequence TGGTTATCTCAGAAGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915039018_915039023 12 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039023 1:152952234-152952256 GCTCCTACCAGGGTAAGATGTGG No data
915039018_915039021 1 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039021 1:152952223-152952245 ACATTTACAAGGCTCCTACCAGG No data
915039018_915039024 13 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039024 1:152952235-152952257 CTCCTACCAGGGTAAGATGTGGG No data
915039018_915039019 -10 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039019 1:152952212-152952234 GAGATAACCAGACATTTACAAGG No data
915039018_915039027 15 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039027 1:152952237-152952259 CCTACCAGGGTAAGATGTGGGGG No data
915039018_915039022 2 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039022 1:152952224-152952246 CATTTACAAGGCTCCTACCAGGG No data
915039018_915039025 14 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915039018 Original CRISPR TGGTTATCTCAGAAGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr