ID: 915039020

View in Genome Browser
Species Human (GRCh38)
Location 1:152952219-152952241
Sequence GTAGGAGCCTTGTAAATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915039020_915039029 30 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039029 1:152952272-152952294 CAGATGCACACAACATTCAAAGG No data
915039020_915039027 -5 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039027 1:152952237-152952259 CCTACCAGGGTAAGATGTGGGGG No data
915039020_915039023 -8 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039023 1:152952234-152952256 GCTCCTACCAGGGTAAGATGTGG No data
915039020_915039024 -7 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039024 1:152952235-152952257 CTCCTACCAGGGTAAGATGTGGG No data
915039020_915039025 -6 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915039020 Original CRISPR GTAGGAGCCTTGTAAATGTC TGG (reversed) Intergenic
No off target data available for this crispr