ID: 915039025

View in Genome Browser
Species Human (GRCh38)
Location 1:152952236-152952258
Sequence TCCTACCAGGGTAAGATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915039020_915039025 -6 Left 915039020 1:152952219-152952241 CCAGACATTTACAAGGCTCCTAC No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data
915039018_915039025 14 Left 915039018 1:152952199-152952221 CCTGGAGGCTTCTGAGATAACCA No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data
915039017_915039025 15 Left 915039017 1:152952198-152952220 CCCTGGAGGCTTCTGAGATAACC No data
Right 915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915039025 Original CRISPR TCCTACCAGGGTAAGATGTG GGG Intergenic
No off target data available for this crispr