ID: 915042651

View in Genome Browser
Species Human (GRCh38)
Location 1:152981861-152981883
Sequence CCTGGCGTGCAGAAGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915042651_915042657 4 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042657 1:152981888-152981910 GTGTGAGGATGGAGATGGATAGG No data
915042651_915042658 5 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042658 1:152981889-152981911 TGTGAGGATGGAGATGGATAGGG No data
915042651_915042656 -1 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042656 1:152981883-152981905 GCACTGTGTGAGGATGGAGATGG No data
915042651_915042659 13 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042659 1:152981897-152981919 TGGAGATGGATAGGGACCAATGG No data
915042651_915042662 30 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042662 1:152981914-152981936 CAATGGCTGCATGGACACAGTGG No data
915042651_915042654 -7 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042654 1:152981877-152981899 CGCCAGGCACTGTGTGAGGATGG No data
915042651_915042660 21 Left 915042651 1:152981861-152981883 CCAAGCAGCTTCTGCACGCCAGG No data
Right 915042660 1:152981905-152981927 GATAGGGACCAATGGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915042651 Original CRISPR CCTGGCGTGCAGAAGCTGCT TGG (reversed) Intergenic
No off target data available for this crispr