ID: 915043257

View in Genome Browser
Species Human (GRCh38)
Location 1:152985973-152985995
Sequence GGACACTCCTGGGCTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915043251_915043257 24 Left 915043251 1:152985926-152985948 CCTGACACTGAGAATGTGTGTGA 0: 1
1: 0
2: 1
3: 23
4: 267
Right 915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG 0: 1
1: 0
2: 3
3: 30
4: 314
915043250_915043257 29 Left 915043250 1:152985921-152985943 CCGATCCTGACACTGAGAATGTG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG 0: 1
1: 0
2: 3
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915043257 Original CRISPR GGACACTCCTGGGCTGGAAG TGG Intergenic
900373133 1:2341128-2341150 GGACACAGCAGGGCTGGGAGAGG - Intronic
900530317 1:3149791-3149813 GGAGGCTCCTGGGCTGGCTGGGG + Intronic
900975681 1:6014861-6014883 GGACACTCTGAGTCTGGAAGGGG - Intronic
902795887 1:18800128-18800150 GGACACTTCTGGGCTCCATGAGG + Intergenic
903214635 1:21836963-21836985 GGACCCTGCTGGGATGGAGGTGG + Exonic
903403991 1:23081022-23081044 AGACAGTCCTGGGCTTGGAGGGG + Intronic
903457648 1:23498979-23499001 GGACATTTCTGGGCTGGGCGTGG - Intergenic
903692426 1:25183900-25183922 GGACAGGCCTGGGCTGGAGCAGG - Intergenic
903779899 1:25814481-25814503 GGCCAGTCCTGGGATGGAAGGGG + Intronic
903888676 1:26555697-26555719 GGCCACATCTGGGCTGAAAGGGG + Intronic
904623529 1:31789459-31789481 GGCCCCTGCTGGACTGGAAGGGG - Intergenic
904698462 1:32344062-32344084 GGACACTTATGGGTTGCAAGAGG - Intergenic
904976774 1:34462589-34462611 GCCCACCCCTGAGCTGGAAGTGG + Intergenic
906151170 1:43588540-43588562 GGCCACTTCTAGGCTGGAAGTGG + Intronic
907840812 1:58155509-58155531 GGAGACTCCAAGGCTGGATGGGG - Intronic
908381930 1:63605052-63605074 GCACACTCCTGTCCTGGCAGTGG + Intronic
910929670 1:92430591-92430613 GGTTACCCCTGGGGTGGAAGTGG - Intergenic
912759839 1:112357091-112357113 AGAGGCTCCTGGACTGGAAGGGG - Intergenic
913360359 1:117973864-117973886 GGACACTCATGGGCATAAAGAGG - Intronic
914858070 1:151366446-151366468 GTACAGTCCTGGGGTGGGAGTGG + Exonic
914884550 1:151574427-151574449 CTGGACTCCTGGGCTGGAAGGGG + Intronic
915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG + Intergenic
915308226 1:154993340-154993362 GGCACCACCTGGGCTGGAAGAGG + Intergenic
915680636 1:157578822-157578844 GGACTCTCCTGGGCCTGGAGCGG + Exonic
915830216 1:159121848-159121870 TTAAACTCCTGTGCTGGAAGTGG - Intronic
916080775 1:161230764-161230786 GGCCACACCAGGGCAGGAAGGGG - Intronic
916289507 1:163148912-163148934 GGTCTCTCCTGGGCTGTTAGAGG + Intronic
917856930 1:179108623-179108645 GGACCCTCCAGGGGTGGGAGTGG - Exonic
919809414 1:201399368-201399390 GATCCCACCTGGGCTGGAAGGGG - Exonic
919829713 1:201531788-201531810 GGACAAGCGTGGGCTGGAAGAGG + Intergenic
920988614 1:210914503-210914525 AGATACTGCTGGGCTGCAAGTGG + Intronic
922516097 1:226209390-226209412 GGACCCTCCTGTGCTGGGATTGG - Intergenic
1063278843 10:4602335-4602357 GGACTGTCCTGGTCTGGAGGTGG + Intergenic
1063463404 10:6228607-6228629 GGACACTCCTGGGGCAGGAGGGG - Intronic
1064473334 10:15659847-15659869 GGACCATCAGGGGCTGGAAGGGG + Intronic
1065754980 10:28922907-28922929 GGAGACTGCAGGGCTGGAAGAGG - Intergenic
1066466518 10:35655174-35655196 AGAAACTCCTGGGCTGGGCGCGG - Intergenic
1067656647 10:48197400-48197422 GGACACTCCAGCTCTGAAAGGGG + Intronic
1067705589 10:48604578-48604600 TGAAACTCCTGGGCTGGGTGGGG - Intronic
1067856389 10:49797113-49797135 GAACACCCTTGGCCTGGAAGAGG + Intergenic
1071564404 10:86664319-86664341 GGACATACCTGGGGAGGAAGGGG + Intronic
1071956492 10:90766395-90766417 GGAGACACATGGGCTGAAAGTGG - Intronic
1073461007 10:103665876-103665898 AGCCTCTCCTGGGTTGGAAGGGG + Intronic
1076373842 10:129970908-129970930 GTGCACGCCGGGGCTGGAAGGGG + Intergenic
1076573552 10:131449047-131449069 GGGCACCCCTGGGATGGGAGCGG - Intergenic
1076576683 10:131474252-131474274 GGGCACACGTGGGCTGGGAGGGG - Intergenic
1076711543 10:132338465-132338487 GGAAACTCCTGGAAGGGAAGTGG - Intronic
1077216624 11:1397814-1397836 GGACACTTCTGGGATGGAGCTGG + Intronic
1077278894 11:1733082-1733104 GGACAAGCCTGGGCTGGAAGAGG - Exonic
1077288656 11:1778758-1778780 GGTCCCTCCAGGACTGGAAGTGG - Intergenic
1077391489 11:2302519-2302541 GCACCCTCCGGGGCAGGAAGGGG - Intronic
1078110036 11:8384995-8385017 GGCCAGGCCTGGGCTGGCAGTGG - Intergenic
1078190382 11:9089273-9089295 GGAGCCTCCTGAGCTGGTAGGGG + Intronic
1079996952 11:27305041-27305063 GCAGGCTCCTGGGCTGAAAGGGG + Intergenic
1081020155 11:37936487-37936509 GGCCATTCCTGGGCTCGGAGGGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083189572 11:61040260-61040282 AGACACTTCTGGGCTGTAGGAGG - Intergenic
1083466056 11:62847043-62847065 GAACGCTCCTGGGCTGGGAGCGG - Intergenic
1083659619 11:64246103-64246125 GGGCTATCCTGGGCTGGCAGCGG - Intronic
1084428823 11:69100319-69100341 GAGCCCTCCGGGGCTGGAAGAGG + Intergenic
1084797731 11:71519349-71519371 GGCCCCTCCTGGGCTGGGGGCGG + Intronic
1085070357 11:73538477-73538499 GGACTCTGCTGGGCTGGGTGAGG - Intronic
1088154474 11:106786519-106786541 GGACATTCCTGTGCAGGAATTGG - Intronic
1089095690 11:115918282-115918304 GGACTCTCCTCTGCTGGAATTGG - Intergenic
1089366340 11:117923227-117923249 CGAGACCCCTGGGCTGGAAGTGG - Intronic
1089537792 11:119171275-119171297 GGTCCCTCCTTGGCTGGAATGGG + Intronic
1090181999 11:124707883-124707905 GGAGACTTCAAGGCTGGAAGTGG + Intergenic
1090417369 11:126549797-126549819 GCAGCCTCCTGGGGTGGAAGCGG + Intronic
1090606133 11:128424606-128424628 GGACACCTTCGGGCTGGAAGGGG - Intergenic
1090709732 11:129374190-129374212 GGACGCTTCTAGGCTGGGAGCGG + Intergenic
1090798690 11:130157092-130157114 GTGCACTCCTGGGTTGGAGGAGG - Intergenic
1091320689 11:134647232-134647254 GGAGGCTCCTGTGCTGGGAGGGG - Intergenic
1091727415 12:2855539-2855561 TGAGAATCCTGGGCTGGCAGAGG - Intronic
1091762071 12:3094154-3094176 GAAGACTCCTGGGCTGGGCGTGG - Intronic
1091893445 12:4081756-4081778 GGAAAGTCCTGGGATGCAAGTGG + Intergenic
1093393286 12:18649925-18649947 GGACACTCCAGCACTGGAGGTGG - Intergenic
1093450148 12:19305166-19305188 TGACACCCATGGGCTGGAAATGG - Intronic
1100363739 12:93900434-93900456 TGACACTGGTGGGCTGGGAGAGG - Intergenic
1101010862 12:100447619-100447641 GGAGACTGCAGGGCTAGAAGAGG - Intergenic
1102030625 12:109738174-109738196 GGACATTCCTGGGCTGGGCAAGG + Intronic
1102775871 12:115518649-115518671 GGAGACCCATGGCCTGGAAGGGG + Intergenic
1103134831 12:118498307-118498329 GGCCTCTCATGGGCAGGAAGGGG + Intergenic
1103392460 12:120584549-120584571 GCACCCTCCTGGGCCAGAAGGGG - Intergenic
1106086662 13:26548779-26548801 GGGCACTGCAGGGCTGGAAATGG - Intergenic
1107229031 13:38086243-38086265 GGAGACTCCTGGGCGCGAAGGGG + Intergenic
1107695063 13:42992069-42992091 GGACCCTTCTGGGCGGCAAGGGG - Exonic
1110821807 13:79925860-79925882 GGAAGCCCCTGGGGTGGAAGGGG - Intergenic
1112625016 13:101094033-101094055 AGGCACTCCTGGGCTGGAGAGGG - Intronic
1112997637 13:105593957-105593979 GGGCACTTCTGGGCTTGTAGAGG - Intergenic
1113747686 13:112756414-112756436 TGCCTCTCCTGGACTGGAAGGGG - Intronic
1113775846 13:112944172-112944194 GGAGGCTCCTGGGCTGTGAGGGG + Intronic
1114525757 14:23366116-23366138 GGACTCGCCTGGGCTGGGAGTGG + Intergenic
1116493322 14:45531983-45532005 GGACACACATGGGCTGAAAGTGG - Intergenic
1116786490 14:49294238-49294260 GGGCAACCCTGGGCTGGGAGTGG + Intergenic
1116862230 14:50003732-50003754 AGACGTTCCTGGGCTGGGAGAGG - Intronic
1118124724 14:62889054-62889076 GGACATTCATGGGCTGGAAGTGG + Intronic
1121360098 14:93249158-93249180 GGACACTGAGGGACTGGAAGGGG + Intronic
1121724809 14:96139548-96139570 GGACAGTGGTGGGCTGGAGGTGG - Intergenic
1122855608 14:104558706-104558728 GGATGCTCTTGGGCTGGAGGTGG - Intronic
1122999399 14:105284388-105284410 CGACACACCTAGGCTGGCAGGGG - Intronic
1123037297 14:105476728-105476750 GGACACACCAGGGCAGGCAGGGG - Intronic
1123054158 14:105561332-105561354 GGACAAGCCGGGGCTGGACGGGG - Intergenic
1123078741 14:105681749-105681771 GGACAAGCCGGGGCTGGACGGGG - Intergenic
1123100359 14:105793472-105793494 GGACACTTCTGGGTCAGAAGGGG + Intergenic
1123163475 14:106302515-106302537 GCTCACTCATGCGCTGGAAGAGG - Intergenic
1123768136 15:23501894-23501916 GGACATTCCTGGGCAGCAACAGG - Intergenic
1124069971 15:26381951-26381973 GGACAAGCCTGGATTGGAAGAGG - Intergenic
1124570154 15:30855672-30855694 GGACATTCCTGGGCAGCAACAGG + Intergenic
1125427634 15:39565661-39565683 GGAAAATCCTGGGCTGGCAAAGG - Intergenic
1125590959 15:40854222-40854244 GGACGATGCTGGGCTGGAAGGGG - Intronic
1125692279 15:41605852-41605874 GGAGACTGATGGTCTGGAAGAGG + Intergenic
1125760893 15:42094718-42094740 TGAAACTCCAGGTCTGGAAGAGG - Intergenic
1125771622 15:42171316-42171338 ACACACTCATGAGCTGGAAGAGG - Intronic
1125893886 15:43286193-43286215 AGCTACACCTGGGCTGGAAGTGG + Intronic
1126245293 15:46498127-46498149 GGCCACAGCGGGGCTGGAAGAGG + Intergenic
1128577845 15:68788490-68788512 GGACAGTGCTGGGCTAGAGGTGG - Intronic
1130550015 15:84884386-84884408 GGAGTCTCCTGGCCTGGAGGAGG + Intergenic
1131076758 15:89500124-89500146 GAAGACTTCTGGACTGGAAGAGG - Intergenic
1132097378 15:98997862-98997884 GGACCCTCCTGGGAGGGATGGGG - Intronic
1132299848 15:100768688-100768710 GTTAACTCCCGGGCTGGAAGAGG - Intergenic
1132762668 16:1518424-1518446 GGAGACTCTTGGCCTGTAAGAGG + Intronic
1132974239 16:2703533-2703555 GGACAGTCCTGGGCTGCTGGTGG - Intronic
1134125380 16:11612661-11612683 GGCCAGTTCTGGGCTGGGAGTGG - Intronic
1134412624 16:14015637-14015659 CGAAACTACTGGGCTGGAGGTGG + Intergenic
1134425067 16:14134198-14134220 TAACATTCCTGTGCTGGAAGTGG - Intronic
1134845030 16:17433017-17433039 GGAAGCTCCTGGGCTGGGATTGG - Intronic
1136552741 16:30990201-30990223 GGAAACACCTGGGCTGAATGGGG + Exonic
1136771840 16:32847015-32847037 GCTCACTCATGCGCTGGAAGAGG + Intergenic
1136898768 16:34014506-34014528 GCTCACTCATGCGCTGGAAGAGG - Intergenic
1137673986 16:50294797-50294819 GGACACCCCTGGGGTGTAATAGG - Intronic
1137859805 16:51834986-51835008 GAACACTCCTGGGCCTGGAGTGG - Intergenic
1138304324 16:55960488-55960510 GGACACCTCAGGGCTGGAAGGGG - Intergenic
1139956520 16:70695855-70695877 GCACCCTCCCGGGCTGGGAGAGG + Intronic
1140472836 16:75224790-75224812 GTACACGCCAGGGCTGGAGGTGG - Exonic
1140683138 16:77405134-77405156 GGCCACCCCTGGGCTGGGACTGG + Intronic
1141252339 16:82369928-82369950 GGGGCCACCTGGGCTGGAAGGGG + Intergenic
1141590657 16:85066575-85066597 GGCCCATCCTGGGCTGGAAACGG - Intronic
1141743178 16:85907859-85907881 GGAAACTGTTGGGTTGGAAGTGG + Intronic
1141768432 16:86073924-86073946 GGACAGTCCTGGGCAAGCAGGGG - Intergenic
1203074260 16_KI270728v1_random:1109104-1109126 GCTCACTCATGCGCTGGAAGAGG + Intergenic
1142968535 17:3595940-3595962 GTACACTCCAGGCCTGGCAGTGG - Intronic
1143501538 17:7342260-7342282 AGACACTCCTAGGCAAGAAGAGG - Exonic
1144665298 17:17098385-17098407 GGACAGGCCTGGGTGGGAAGAGG - Intronic
1145009182 17:19357748-19357770 GAACAGTCATGGGCTGGATGAGG + Intronic
1145902136 17:28496143-28496165 GAACACGCCTGGGGAGGAAGGGG - Intronic
1146442620 17:32910435-32910457 GGACAACTGTGGGCTGGAAGAGG - Intergenic
1147623353 17:41883085-41883107 GGTCACTTCTGGGCTGGGAGTGG - Intronic
1148147327 17:45373990-45374012 GGGAACTGCTGGGTTGGAAGGGG - Intergenic
1148683957 17:49490399-49490421 GCTGACTCCTGGGCTGCAAGGGG - Intergenic
1149829311 17:59857312-59857334 GGAGATCCCAGGGCTGGAAGTGG + Intergenic
1151550437 17:74819612-74819634 GGGCACACCTGGACTGGCAGAGG - Intronic
1151625511 17:75273099-75273121 ACACACTCCTGGTCTGGATGGGG - Exonic
1151651390 17:75472199-75472221 GCACACCCCTGGGCAAGAAGTGG - Intronic
1152249202 17:79202861-79202883 GGGCAGTCCTTGGCTGGACGGGG + Intronic
1152450715 17:80377835-80377857 GTGCACTCCTGGGTTGGAGGAGG + Intronic
1152520118 17:80850836-80850858 TGGCACTCCAGGGCTGGAACTGG + Intronic
1153170453 18:2310515-2310537 GGTAACTGCTGGGCTCGAAGTGG - Intergenic
1153921234 18:9792214-9792236 GGACACTGCTGGTCAGGAACGGG + Exonic
1154502499 18:15003755-15003777 GTGCACTTCTGAGCTGGAAGAGG - Intergenic
1155325483 18:24660305-24660327 GGCCACACCTGTGCAGGAAGTGG - Intergenic
1156448323 18:37253047-37253069 GGGAACACGTGGGCTGGAAGAGG + Intronic
1156467429 18:37356646-37356668 GGGCCCTCCTGGGCTGGCAGTGG + Intronic
1158189298 18:54807778-54807800 GGATACTTCTGTGCTGGCAGGGG + Intronic
1159260258 18:66004594-66004616 GAACCCCCATGGGCTGGAAGTGG + Intergenic
1160912182 19:1479584-1479606 GGACCCGCCTTGGCCGGAAGTGG - Intergenic
1161144351 19:2668639-2668661 AGCCGCTCCTGGGCTGGAGGAGG + Intronic
1161399246 19:4060151-4060173 GGCCCCTCCTGGGCTGGAGGTGG + Intronic
1161545467 19:4877892-4877914 GGACACTCCTGGCCTAGGAGAGG - Intergenic
1161643276 19:5436979-5437001 GGACCCTACTGGGCCCGAAGAGG - Intergenic
1162668894 19:12237992-12238014 GGAAGCTACTGGGCTGGAACAGG + Intronic
1163188505 19:15658418-15658440 GGAGCCTCCTGGGTAGGAAGAGG + Intronic
1163216279 19:15879720-15879742 GGAGTCTCCTGGGTAGGAAGAGG - Intronic
1163358466 19:16829927-16829949 GGACCCCCCTGGGCCGGAATCGG + Intronic
1163698680 19:18776467-18776489 GGACACTTCCAGCCTGGAAGAGG - Intronic
1164399160 19:27890928-27890950 GGAGACTCACTGGCTGGAAGCGG + Intergenic
1164436694 19:28236588-28236610 GGAGCCCCCTGGGCAGGAAGCGG + Intergenic
1164723013 19:30445671-30445693 GGGCACTCCCGGTCTGGGAGAGG - Exonic
1165066530 19:33232447-33232469 GGAGATACCTGGGCTGGACGTGG - Intergenic
1165943705 19:39428712-39428734 GGACACATCTGGACTGGAAAGGG - Intergenic
1166356296 19:42229472-42229494 GGACACCCCAGAGGTGGAAGGGG - Intergenic
925336171 2:3100838-3100860 GGGCCCTCCTGGGCTTGAAAGGG + Intergenic
926170727 2:10551032-10551054 GGACACTCCTGGGGGGGTGGGGG - Intergenic
927284780 2:21345257-21345279 GGACACTTCAGGCCTGGATGTGG + Intergenic
932441841 2:71742547-71742569 GGACAGTCCTGGGCTAGGTGAGG + Intergenic
934031652 2:88054434-88054456 AGACACTCCTGAGTTGTAAGAGG - Intronic
936997850 2:118434019-118434041 GAAATATCCTGGGCTGGAAGTGG + Intergenic
938501678 2:131833927-131833949 GTGCACTTCTGAGCTGGAAGAGG - Intergenic
939096251 2:137836807-137836829 GCACACTCCTAGGCTGGGGGTGG - Intergenic
939412071 2:141840598-141840620 AAACAGTACTGGGCTGGAAGCGG - Intronic
941013013 2:160322715-160322737 GGAGCCTCTTGTGCTGGAAGTGG - Intronic
941269683 2:163409548-163409570 GGACTCTCCTGGCCTGGGAAAGG + Intergenic
941693549 2:168527104-168527126 GGAGGCTGCTTGGCTGGAAGAGG + Intronic
948523138 2:238554278-238554300 GGACAGGCCTGGCCTGGGAGGGG - Intergenic
1168908337 20:1424808-1424830 GGACCCTCCTGCACTGAAAGTGG - Intergenic
1169076073 20:2760459-2760481 GGCCACGCCTGGGCTGGGTGGGG + Intergenic
1169230984 20:3888961-3888983 GAGCACTGCTGGGCTGGAGGAGG + Intronic
1169351337 20:4870603-4870625 AGACATTGTTGGGCTGGAAGAGG + Intronic
1169422531 20:5471613-5471635 GGACAAGCCTGGGATGGAAAGGG + Intergenic
1172214858 20:33227967-33227989 GAATACTCCTGGGCTCCAAGAGG + Intergenic
1173913635 20:46689548-46689570 GGACACTTCCGGCCTGTAAGTGG + Exonic
1175529234 20:59662761-59662783 GGCCAGTCCTGGGCTGGAAATGG + Intronic
1176110689 20:63409461-63409483 GGCCACTGCTGGGCTGGCAGGGG + Intronic
1179547870 21:42124559-42124581 GGACACTCATGGGCAGGGTGGGG + Intronic
1179597045 21:42449936-42449958 GGACAGAGCTGGGCTGGAAAAGG + Intergenic
1179821625 21:43940394-43940416 GAACGGTCCAGGGCTGGAAGAGG - Intronic
1179971657 21:44839173-44839195 GGACTTTCCTGGGCTCCAAGAGG - Intergenic
1182343160 22:29640841-29640863 GGACACTCTTAGGCTGGGCGTGG + Intronic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
1183078871 22:35443689-35443711 GGAGGCTGCAGGGCTGGAAGTGG - Intergenic
1183509466 22:38226583-38226605 GCTCACTCCGGGGCTGGCAGCGG + Intronic
1183747496 22:39700033-39700055 GGCCTCCCCTGGGCTGGAACAGG - Intergenic
1183778040 22:39980689-39980711 GCACAGTCCTGGGCTGGCTGAGG - Intergenic
1184341058 22:43886204-43886226 AGGCACTCGTGGTCTGGAAGAGG - Intronic
1184676029 22:46044094-46044116 GGAGACACCTGGGCTGGGGGAGG - Intergenic
1185157420 22:49202511-49202533 AGACACACCTAGGCTGGACGAGG + Intergenic
949859746 3:8494524-8494546 GACCACCCCTAGGCTGGAAGAGG + Intergenic
950215654 3:11156356-11156378 GGCCAATGCTGGGCTGGGAGTGG + Intronic
950475263 3:13210792-13210814 GGACACTCCTAGGGGAGAAGGGG + Intergenic
953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG + Intergenic
954130886 3:48560366-48560388 GGACAATCCTTTGCTGGAAATGG - Intronic
954707851 3:52490532-52490554 TGACTCCCCTGAGCTGGAAGAGG + Intronic
961358953 3:126355894-126355916 GGACACTCTAGGGCTGGAGCTGG + Intronic
961478070 3:127160994-127161016 AGACACACCTGGGTTGGAGGTGG - Intergenic
961478437 3:127163590-127163612 GGGCATTCTTGGGCTGTAAGGGG + Intergenic
961626721 3:128269258-128269280 GGAGATGCCTGGGCTGGTAGTGG + Intronic
964382363 3:156110270-156110292 GGACACTTTTGAGCAGGAAGAGG - Intronic
965108619 3:164390176-164390198 GGGGACTTCTGGGTTGGAAGAGG + Intergenic
965799157 3:172473993-172474015 GGACAGCCCAAGGCTGGAAGCGG + Intergenic
966946351 3:184779588-184779610 AGACTCTCCTGGGCTGGGTGCGG + Intergenic
968905806 4:3450010-3450032 GGTCACTGCTGGGCAGGCAGAGG + Intergenic
969697222 4:8741643-8741665 TGGCACTCCTTGGCTGGCAGCGG - Intergenic
969847587 4:9931364-9931386 GCAAACTCCTGGGCTGGGAGAGG + Intronic
977512528 4:97979425-97979447 AGACACTCCTGTTCAGGAAGAGG - Intronic
978656308 4:111069696-111069718 GGACACATCAGGGCTAGAAGAGG - Intergenic
979450576 4:120865832-120865854 GGATACTCTTGGTCAGGAAGAGG - Intronic
979461884 4:120993104-120993126 GCACACTGCTGGGCTGGACATGG - Intergenic
979472788 4:121121328-121121350 GGACACTCCTTTGCTGGAATTGG - Intergenic
980894089 4:138844945-138844967 GGCCACCCCTAGGCTGCAAGTGG - Intergenic
982388294 4:154836737-154836759 TGAGACTGCTTGGCTGGAAGGGG - Intergenic
985633902 5:1026782-1026804 GGTCACTGCTGGCCTGGACGTGG + Intronic
985640245 5:1060246-1060268 GGACCCTCGTGGGCTGCAGGAGG + Intronic
988898288 5:35702143-35702165 GGATCCTGCTGGTCTGGAAGGGG - Intronic
992468573 5:77031002-77031024 GGCCTCGCCTGGGCTGGATGGGG - Intronic
992590581 5:78292271-78292293 GGAGACCCCTGTTCTGGAAGTGG - Intronic
992693317 5:79260233-79260255 GGAGACTCCAGGCCTGGGAGTGG + Intronic
993207011 5:84894997-84895019 GCACTCTCATGGGCTGGTAGTGG - Intergenic
995797894 5:115961605-115961627 AGAAATTCCTGGGCTGGAACTGG - Intergenic
997436278 5:133877962-133877984 GGGGATTCCTGGGCTGGAATGGG - Intergenic
998136595 5:139677309-139677331 GGCCCTTCCTGGCCTGGAAGGGG + Intronic
998266186 5:140669423-140669445 GGCCACTACTGGCCAGGAAGCGG - Exonic
999232107 5:150067752-150067774 GGACACCCCTGGGCTGAGACAGG + Intronic
999433640 5:151545006-151545028 GGACACTCATGAGTTGGCAGTGG - Exonic
1000435213 5:161199686-161199708 TAACACTCCTGGATTGGAAGTGG + Intergenic
1001209896 5:169800867-169800889 GGGCACTTCTGGGATGAAAGCGG + Intronic
1002070684 5:176677468-176677490 GGGCTCTCCTGGGCTGGGTGGGG + Intergenic
1002099757 5:176851588-176851610 GGCCACACCTGGGCTGGGGGCGG + Intronic
1002276485 5:178107334-178107356 GAACAATCTTGGGCTGGATGTGG + Intergenic
1002297947 5:178241715-178241737 GGGCCATCTTGGGCTGGAAGTGG - Intronic
1002345500 5:178545366-178545388 TGACACTAATGGGCTTGAAGTGG - Intronic
1002640091 5:180626636-180626658 GGACCCTCCTGGGCTGGGCTGGG - Intronic
1003516624 6:6823876-6823898 TGACACTCCTTGGCAGGAAGAGG + Intergenic
1005718981 6:28582177-28582199 GAACTGTCCTGGGCTGCAAGTGG - Intronic
1006025865 6:31146371-31146393 CGACACTCCTGGGCTTGGAGAGG - Intronic
1006447792 6:34089610-34089632 GGGCACTCCTGTCCTGGCAGAGG - Intronic
1007174861 6:39888768-39888790 GGACCCTCGTGGGAAGGAAGGGG + Intronic
1007710859 6:43823293-43823315 GAACACACCTGGGTTGGAAATGG - Intergenic
1007798863 6:44375079-44375101 GGACATTTCTGGGCTGCATGTGG - Intronic
1008641377 6:53466022-53466044 GCAAAGTCCTGGGCTGCAAGTGG - Intergenic
1013354553 6:109335504-109335526 GCACACCCCTGGCCTGGAAGTGG + Intergenic
1016163340 6:140908319-140908341 ACAGACTCCTGGGCAGGAAGGGG - Intergenic
1017156106 6:151324010-151324032 GGACACTCTGGGGCTGGGATTGG + Intronic
1018395379 6:163374196-163374218 GCACAGTTCTGGGCTGGAAGGGG + Intergenic
1018963250 6:168463793-168463815 GCACACTCCTAGGTGGGAAGAGG + Intronic
1019214945 6:170437502-170437524 GGACATTCCTGGGATGGGATAGG + Intergenic
1019578548 7:1749142-1749164 GGAGACTCCAGGGCAGGAACCGG + Intergenic
1020111804 7:5451847-5451869 GGACCCTCCTGGGGTGGGACTGG - Intronic
1020816061 7:12907657-12907679 GGACTCACTTGGTCTGGAAGTGG + Intergenic
1021315497 7:19143933-19143955 GGTCACTCCTGGGCCGCAGGGGG - Intergenic
1021702946 7:23337956-23337978 AGACAATCCAAGGCTGGAAGTGG - Intronic
1024509884 7:50195666-50195688 GGACAAGCCTGGCCTGGAGGAGG + Intergenic
1024983592 7:55177725-55177747 GGACACTCCTGCGGTGGGACTGG + Intronic
1025140719 7:56461185-56461207 GGAGACCCCTGGGCTGGGGGAGG + Intergenic
1027249557 7:76390384-76390406 GGACAGGGCTGGGTTGGAAGGGG + Intronic
1028985730 7:97006777-97006799 GGACATTTCTGGGCCGGAACTGG + Intronic
1029148398 7:98463161-98463183 GGACGCTCTTGGCCTGGGAGTGG - Intergenic
1029193938 7:98791276-98791298 AGGCACTCCTGGGCTGGCACCGG - Intergenic
1029283178 7:99449771-99449793 GGGGATTCCTGAGCTGGAAGCGG + Intronic
1029479779 7:100805435-100805457 GGACACTTCTGGGCAAGGAGTGG + Intronic
1029607123 7:101605890-101605912 GGACATGGCTGGGGTGGAAGTGG - Intergenic
1032006292 7:128304633-128304655 GGACACTGCTGGCCTGGATAGGG + Exonic
1032216223 7:129959416-129959438 GGTAAATCCTAGGCTGGAAGGGG - Intergenic
1033595769 7:142856694-142856716 AGAAACACCTGGGCTGGGAGAGG - Intronic
1033652188 7:143351869-143351891 GGAGAGTCCAGGGCTGGAAGAGG + Exonic
1034055539 7:148031233-148031255 AAACACTCCTGGGCTGTAAAAGG + Intronic
1034443729 7:151101229-151101251 GGCCCCTCCTGGGCTGGTGGGGG + Intronic
1034731315 7:153389842-153389864 TGACATTCCTGGGTTGGAGGGGG - Intergenic
1036135916 8:6161440-6161462 GGACATTCCTGGGTAGGAAATGG + Intergenic
1036801595 8:11796537-11796559 GGACACTCCGAGGCAGGCAGGGG + Intronic
1037096579 8:14993537-14993559 GGAAATTCTTGGGCTGAAAGAGG + Intronic
1037234968 8:16709059-16709081 GGACATTCCAGGGCAGGAGGGGG - Intergenic
1037389356 8:18377194-18377216 GGACACACATGGACTGAAAGTGG + Intergenic
1039479041 8:37858248-37858270 TGAGACTCCTGGGCTGGGATGGG - Intergenic
1040288868 8:46114142-46114164 GGAGGCTCCTGGGATGGAAGAGG + Intergenic
1040290400 8:46121266-46121288 GGGGACTCCTGGGATGGGAGAGG + Intergenic
1040298927 8:46177993-46178015 GCAGGCTCCTGGGATGGAAGAGG - Intergenic
1040300987 8:46187909-46187931 GGAGGCTTCTGGGATGGAAGAGG + Intergenic
1040315998 8:46261232-46261254 GGGGGCTCCTGGGATGGAAGAGG - Intergenic
1040316397 8:46263189-46263211 GGGGGCTCCTGGGATGGAAGAGG - Intergenic
1040335998 8:46416298-46416320 GAAGACTCCTGGGATGGGAGAGG - Intergenic
1041314030 8:56543450-56543472 TAACACTCATGGGCTGGCAGGGG - Intergenic
1042066315 8:64880943-64880965 GGAGACTCCTGGAGTGGAGGTGG + Intergenic
1045216164 8:100150558-100150580 GGCCACGCCTGGGGCGGAAGGGG + Intergenic
1047197687 8:122736282-122736304 GGACACTTCTGGGAATGAAGTGG - Intergenic
1047850437 8:128851594-128851616 GGACATCCTTGGGGTGGAAGTGG - Intergenic
1048257428 8:132915576-132915598 GGACACACCTGGGCTGGAACAGG + Intronic
1048977375 8:139680471-139680493 GCACAGTCCTGGGCTGGAGGAGG + Intronic
1049211584 8:141389042-141389064 GGGCCCTGCTGGGCTGGAGGAGG + Intergenic
1049241627 8:141540329-141540351 GGAGACTCAGGGGCTGGGAGTGG - Intergenic
1049312448 8:141940413-141940435 GGAGACTCCTGGGCAGCAGGGGG - Intergenic
1049613668 8:143567277-143567299 CGACGCTCCGGCGCTGGAAGGGG + Exonic
1051370220 9:16352905-16352927 AGACAGTCCGGGGCTGGCAGTGG - Intergenic
1053142216 9:35689362-35689384 GGAGGCTACTGGGATGGAAGCGG + Intronic
1056459205 9:86792857-86792879 AGAAAGTCCAGGGCTGGAAGAGG + Intergenic
1056899092 9:90582344-90582366 GGAGGCTCCTGGGCTGGAGCAGG + Intergenic
1057209292 9:93190972-93190994 GGACACATCAGGGCTGGAAGAGG + Intronic
1059734018 9:117083902-117083924 GGACCATCATGGGCTGGAGGAGG + Intronic
1061035808 9:128113866-128113888 GGAGGCTCCAGGGCAGGAAGGGG - Intergenic
1061081588 9:128374113-128374135 GGTCTCTCCTGGGCTAGAACAGG + Intronic
1061114981 9:128604424-128604446 GGTCAGCCCTGGGCTGGGAGAGG + Intronic
1061160728 9:128892480-128892502 GGAGACGCCAGGGCTGGAGGGGG - Intronic
1061677720 9:132227832-132227854 GGAAGCCCCTGGGCTGCAAGTGG + Intronic
1062267316 9:135693097-135693119 GGAGCCCCCTGGGCTGGGAGAGG + Intergenic
1062379584 9:136280797-136280819 GCACCCTCCTTGGCTGGCAGCGG - Intergenic
1062466600 9:136684402-136684424 GGACACCCCCTGCCTGGAAGGGG + Intronic
1062560219 9:137138335-137138357 GCACACTCCAGGGGTGGAGGGGG + Intergenic
1185488453 X:500450-500472 GAACAGTCCTGGGCAGGAGGAGG - Intergenic
1185689865 X:2145457-2145479 GGACAGTCCAGGGCTGGGCGCGG + Intergenic
1189019566 X:37320224-37320246 AGACACACCTGGGCCGGAAGGGG - Intergenic
1190193943 X:48300917-48300939 GGGAACCCCTGGGCTGGAATGGG + Intergenic
1190281956 X:48936978-48937000 GAACACTCCAGGGTAGGAAGGGG - Intronic
1190663141 X:52673535-52673557 GGAAACCCCTGGGCTGGGACTGG - Intronic
1190676282 X:52784947-52784969 GGAAACCCCTGGGCTGGGACTGG + Intronic
1195094851 X:101493075-101493097 GGAGATTCCTGGGCTGGCACTGG + Exonic
1196197958 X:112855215-112855237 GGACAGGCATGGGCGGGAAGCGG - Intergenic
1199786538 X:151111646-151111668 GGACCCTGCTGTGCTTGAAGGGG + Intergenic
1202242444 Y:22785625-22785647 TGACACTCCTGGGCTGACATTGG + Intergenic
1202349202 Y:23969389-23969411 TCCCAATCCTGGGCTGGAAGAGG + Intergenic
1202521573 Y:25700715-25700737 TCCCAATCCTGGGCTGGAAGAGG - Intergenic