ID: 915047181

View in Genome Browser
Species Human (GRCh38)
Location 1:153028002-153028024
Sequence AAGGAGAAGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915047181_915047188 12 Left 915047181 1:153028002-153028024 CCTCCCTCCTTCTCCTTCTCCTT No data
Right 915047188 1:153028037-153028059 TGTTCCAGAAGCACACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915047181 Original CRISPR AAGGAGAAGGAGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr