ID: 915050786

View in Genome Browser
Species Human (GRCh38)
Location 1:153070362-153070384
Sequence AGCTCTTTCTGCTGAAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915050784_915050786 -6 Left 915050784 1:153070345-153070367 CCCAGGCACACAGCTGCAGCTCT 0: 2
1: 0
2: 2
3: 32
4: 332
Right 915050786 1:153070362-153070384 AGCTCTTTCTGCTGAAGCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 214
915050785_915050786 -7 Left 915050785 1:153070346-153070368 CCAGGCACACAGCTGCAGCTCTT 0: 1
1: 1
2: 2
3: 44
4: 790
Right 915050786 1:153070362-153070384 AGCTCTTTCTGCTGAAGCTCTGG 0: 1
1: 0
2: 1
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915050786 Original CRISPR AGCTCTTTCTGCTGAAGCTC TGG Exonic
901461084 1:9392309-9392331 CTCTCTTTCTGCTGAGACTCTGG + Intergenic
902054360 1:13587908-13587930 ACCTCTTTCGGCTGACACTCAGG - Intronic
902182458 1:14699361-14699383 AGCTCTTTCTTTTGAGCCTCTGG - Intronic
902629920 1:17698646-17698668 AGATCTTTCCACTGAAGTTCTGG + Intergenic
903823376 1:26121479-26121501 AGGTCTATCTGCTGAAACTTTGG + Intronic
904619530 1:31766890-31766912 AGCCCTCTGTGCTCAAGCTCTGG - Intergenic
905271868 1:36792662-36792684 AGCTCTCTCTGCTGAAGGAGTGG + Intergenic
906195947 1:43930882-43930904 AGTTCTTTCTGCTATAGCCCTGG - Exonic
906820354 1:48923292-48923314 AACTCTTTCTGCTGAGCCACAGG + Intronic
910525026 1:88167675-88167697 AGTTCTTTCTGCTGTACCACAGG - Intergenic
911384999 1:97163784-97163806 ATCTCTTACTACTGATGCTCTGG + Intronic
911522545 1:98945901-98945923 AGCACTTTCTCCTAAAGCACAGG - Intronic
913529255 1:119721890-119721912 AGCTGTTTCTGCAGAAACACAGG + Intronic
915048339 1:153039868-153039890 TGCTCTTTCTTCCGAAGCTCTGG + Exonic
915049734 1:153056256-153056278 TGCTCTTTCTTCCGAAGCTCTGG + Exonic
915050786 1:153070362-153070384 AGCTCTTTCTGCTGAAGCTCTGG + Exonic
915054321 1:153112254-153112276 TGCTCTTTCTTCTGAAGCTCTGG + Exonic
916335072 1:163661937-163661959 TTCTCTTCCTGCAGAAGCTCAGG + Intergenic
916361550 1:163975800-163975822 AGCCCTTTCTGCTGTAACTCCGG + Intergenic
919613213 1:199772627-199772649 AGATTTATCTTCTGAAGCTCAGG + Intergenic
920973048 1:210758745-210758767 GGCTCTTTCTGTTGGGGCTCAGG + Intronic
1063139365 10:3242962-3242984 AGCTCTTTCTGCTCAGGGTAAGG - Intergenic
1063393323 10:5664246-5664268 AGCTCTGCCTGCTGCTGCTCTGG - Intronic
1063584544 10:7339920-7339942 AGCTCATCCTGCTGACCCTCTGG - Intronic
1067290550 10:44936520-44936542 AGCTCTTCCTGCAGTAGCCCAGG + Exonic
1069950184 10:72013313-72013335 AGCTCATTCTGCTCAGCCTCTGG + Exonic
1072122493 10:92416616-92416638 AACTCTGGATGCTGAAGCTCAGG - Intergenic
1073625024 10:105088140-105088162 AGCTCTTCCTGCTGGAAGTCAGG + Intronic
1074203487 10:111260106-111260128 AGCTGCTTTTGCTGAAGCTAGGG - Intergenic
1075263213 10:120980238-120980260 GGGGGTTTCTGCTGAAGCTCAGG + Intergenic
1075742740 10:124705761-124705783 AGGTCTATCTGCTCAAGGTCTGG + Intronic
1076081465 10:127585371-127585393 ACCTCATTCTCCTGGAGCTCAGG + Intergenic
1076517184 10:131052897-131052919 AGCATTTTCTGCTGTAACTCAGG + Intergenic
1076794427 10:132791737-132791759 GCCTTTTTCTGCTGAAGCACAGG + Intergenic
1078149937 11:8749789-8749811 AGCCCTTTCTGCTGAATGTCAGG - Intronic
1080383119 11:31794561-31794583 AGCTCTTTGTACTGAAGATGTGG + Intronic
1083181506 11:60988799-60988821 AACTGCTTCTGCTGCAGCTCTGG + Intronic
1085454980 11:76660542-76660564 AGCAGTTTCTGCTGAGGTTCAGG + Exonic
1085730885 11:78997609-78997631 AGCTGTGGATGCTGAAGCTCAGG - Intronic
1086310504 11:85530927-85530949 AACTCTTCCTGCTCAAGTTCAGG - Intronic
1087322635 11:96681851-96681873 AGCTCTTTCTGCTGGGGGTGGGG + Intergenic
1087895548 11:103581920-103581942 TGCTGCTTCTGCAGAAGCTCAGG - Intergenic
1088786021 11:113182625-113182647 AGCTCCTGCTGCTGCTGCTCTGG - Intronic
1088921885 11:114265408-114265430 ATCTTCTTCTGCTGGAGCTCTGG + Intronic
1089325143 11:117651855-117651877 ACCTATTTCTGCAGAGGCTCGGG - Intronic
1090234053 11:125133372-125133394 ATCTCTGTCTGCTGAATCTTGGG + Intergenic
1090879097 11:130817513-130817535 AGCTCTGTGTGCTGAAGCAGAGG + Intergenic
1090885228 11:130870263-130870285 CGGTCTTTCTGCTGAAGAGCAGG - Intergenic
1091041453 11:132285029-132285051 TGCTCTTTCTGCTGCATCTCAGG - Intronic
1092113416 12:5980856-5980878 AGGTCTTCCTGCTGCAGTTCTGG + Intronic
1093164354 12:15788844-15788866 AGGTGTATCTGCGGAAGCTCAGG + Intronic
1093291983 12:17337320-17337342 TGCTCTTTCTTCTGGAGCTTGGG + Intergenic
1095819374 12:46460535-46460557 ACCTCTTTTAGCTGAAGCTGAGG - Intergenic
1098399176 12:70054820-70054842 AGCTCTTTCTCCTCAAGATTGGG - Intergenic
1098605332 12:72382483-72382505 AGCTGTTTCTGCTGAAGTGATGG + Intronic
1099262503 12:80400696-80400718 AGCTCTTGCTGCAGCTGCTCTGG - Intergenic
1100184096 12:92119612-92119634 ATGTTTTTCTGCTAAAGCTCTGG - Intronic
1100813225 12:98360948-98360970 AGCTCTCTCTGCAGAGGCCCTGG + Intergenic
1101130508 12:101686380-101686402 AGCTGTTTTGGCAGAAGCTCTGG - Intergenic
1102288134 12:111676182-111676204 AACTCTTTCAGCTAAAGCTAAGG + Intronic
1103982873 12:124747975-124747997 AGCTTTTGCTGCTGCAGCTCTGG + Intergenic
1104169111 12:126262811-126262833 TCCTCTTACTGCTGAAACTCAGG - Intergenic
1107667606 13:42707875-42707897 AGCTCCGTCAGCAGAAGCTCTGG - Intergenic
1111708509 13:91782135-91782157 AGCTCTTTCGGCTGTTTCTCAGG + Intronic
1111885051 13:94009851-94009873 TGATCTTGCTGCTGAGGCTCAGG + Intronic
1112318734 13:98388444-98388466 AGCGCTTTCTCATCAAGCTCCGG + Exonic
1113371453 13:109729016-109729038 AGCTGTTTCTGCTCAAGCTAGGG + Intergenic
1113682066 13:112251362-112251384 AGCTATGTGGGCTGAAGCTCTGG - Intergenic
1113943588 13:114031770-114031792 AGCTCTAGCTCCTGAGGCTCCGG + Intronic
1114753897 14:25236785-25236807 GGGTTTTTCTGCTGAAGCTTGGG - Intergenic
1118805857 14:69236422-69236444 AGCCCTTTGTGGTGAAGCTACGG + Exonic
1119165146 14:72486298-72486320 AGCTTCTACTGCTGAAGCTGGGG + Intronic
1121308441 14:92922139-92922161 AGCTCTTTGGGCTCCAGCTCTGG - Intergenic
1121530828 14:94651893-94651915 AGCTCTGTCTGCTGGATCCCAGG + Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1124510130 15:30317065-30317087 AGCTGTTTTGGCTGAAGCTCCGG + Intergenic
1124732759 15:32213488-32213510 AGCTGTTTTGGCTGAAGCTCCGG - Intergenic
1125200084 15:37095482-37095504 CCCACTTTCTGCTGGAGCTCTGG - Intronic
1125722617 15:41852439-41852461 AGCTCTTTCAGCTTTGGCTCTGG + Intronic
1129752138 15:78073314-78073336 AGCTCTCTCTGGAGAAGCTGTGG - Intronic
1131223944 15:90608282-90608304 GGCTCTTTCTCCTGAAGGTGAGG - Intronic
1131332420 15:91514269-91514291 AGCTCTGGCTGCTGTACCTCTGG + Intergenic
1131394111 15:92073098-92073120 AGCTCTCTCTGCTAAAACTCTGG - Intronic
1131644675 15:94329003-94329025 AGCTTTTTATGTGGAAGCTCAGG + Intronic
1131815942 15:96221380-96221402 AGCTCTTTGTGCTAAGGCTCAGG + Intergenic
1131819883 15:96261556-96261578 AGCTCTGTTTGGTGAATCTCAGG + Intergenic
1133624960 16:7562593-7562615 ATCTCATTCTGCTGGGGCTCAGG - Intronic
1134612646 16:15622331-15622353 AGCTCTTCCTGCTGAAATACAGG - Intronic
1135253888 16:20925040-20925062 AGCTATTTCTTCTGAGGGTCAGG - Intergenic
1135614529 16:23899412-23899434 AGATCTCTCTGCTGAGGATCAGG + Intronic
1138522586 16:57579388-57579410 AGCTCCCTCTGCTGAAACCCAGG - Intronic
1139478952 16:67217759-67217781 AACCCTCTCTGCTGAAGCCCTGG + Intronic
1140188533 16:72795306-72795328 TGCTCTTGCTGCTGCAGCTCTGG + Exonic
1140982129 16:80120740-80120762 AGCTCTTTCTGAAGAAGATGGGG - Intergenic
1141278902 16:82613047-82613069 AGGGCTTTCTTCTGAAGCTGTGG - Intergenic
1142622147 17:1172000-1172022 GGCTCTATCTACTGAAGCCCAGG + Intronic
1145779668 17:27553913-27553935 AGCCCTTGCAGCTGAAGCCCTGG - Intronic
1146210741 17:30940787-30940809 ATGTTTTTCTGCTGAAGCTTTGG + Intronic
1147401879 17:40185209-40185231 GGCTCTTTCTCCTGCAGCACTGG - Intronic
1150470193 17:65430783-65430805 AGCTGCTTCTGCTGGAACTCGGG - Intergenic
1153116586 18:1664358-1664380 AGTTCTTTCTGATGGAGCTGGGG - Intergenic
1156451215 18:37267389-37267411 TGCTGTCTCTGCTGAAGCTGTGG + Intronic
1157242534 18:46024532-46024554 AACTCTGTCTGCTGAAGCGAGGG + Intronic
1157751236 18:50180192-50180214 AGCTCTGTCTGCTGAATCACTGG - Intronic
1159009319 18:63043245-63043267 AACCCTTTCAGCTGCAGCTCTGG - Intergenic
1159910399 18:74140214-74140236 AGCTCTTTCTCCTGCTGTTCTGG - Exonic
1164591396 19:29509482-29509504 AGCTCTGCTTTCTGAAGCTCTGG - Intergenic
1165923902 19:39315262-39315284 TGCCCTTTCTGCTGCTGCTCTGG - Exonic
1167593201 19:50415326-50415348 AGCTCTTAGGGCTGAGGCTCAGG - Intronic
929128307 2:38540990-38541012 AACTCTTGCTGCTGGACCTCAGG + Intergenic
929315870 2:40477901-40477923 AGCTATTTGGACTGAAGCTCAGG + Intronic
929454439 2:42055959-42055981 TGGTCCTTCTGCTGAAGCCCTGG + Intronic
930325262 2:49908394-49908416 AGCACTGTAAGCTGAAGCTCTGG - Intergenic
936575448 2:113649938-113649960 AGCTTTTCATGCTTAAGCTCAGG + Intergenic
939358838 2:141142420-141142442 AGTTATTTATGCTGAAGCTTAGG - Intronic
940789811 2:158020312-158020334 AGCTCTTTCTTCAGAAGGTTTGG + Intronic
940856360 2:158731379-158731401 AGCCCTTTGTGCTGTGGCTCTGG - Intergenic
943095753 2:183427418-183427440 AGCTCCTTCCTCCGAAGCTCTGG - Intergenic
943451379 2:188046015-188046037 GGCTTTTTCAGCTGTAGCTCAGG + Intergenic
948809150 2:240466113-240466135 AGCTCTTCCTGCTGACCTTCCGG - Exonic
948858214 2:240740467-240740489 AGCTCCCTCTGGTGAAGATCAGG + Intronic
1170439882 20:16368363-16368385 ATCTCATTCTCCGGAAGCTCGGG - Intronic
1173427334 20:42954553-42954575 AGCACTTACTGCTGAAGATGTGG - Intronic
1173884272 20:46443584-46443606 AGCTTTTTCGGCTGTATCTCTGG - Intergenic
1175875303 20:62226724-62226746 AGCTCCTTCTGCTGAGACTGGGG + Intergenic
1177544138 21:22534727-22534749 AGCTCTTGCTGGTGCTGCTCAGG - Intergenic
1177828799 21:26113628-26113650 AGCTATTTCTGCAGATGATCTGG - Intronic
1179420986 21:41236650-41236672 AGCCCTACCTGCTGAAGCCCAGG - Intronic
1179431078 21:41321696-41321718 GGCTCCCTCTGCTGAAGCGCTGG + Intronic
1179573216 21:42290674-42290696 AGCTATTTATGCTAAAGTTCTGG - Intronic
1182881419 22:33737163-33737185 AACTGTTTCTGATGAATCTCAGG + Intronic
1183106132 22:35616496-35616518 AGCTATTACTGATGAAGCCCAGG - Intronic
1184040243 22:41938899-41938921 AGCTCTCCCTGCTGCAGCACTGG + Exonic
1184382771 22:44156218-44156240 AGCTCTCCCTGCTAAAGGTCAGG + Intronic
1185424734 22:50760956-50760978 AGCTTTTCATGCTTAAGCTCAGG - Intergenic
951179743 3:19645153-19645175 AGCTATTACTGCTGAAACCCAGG - Intergenic
951409030 3:22339859-22339881 AACTCTTTCCTCTGAATCTCTGG + Intronic
951620282 3:24593921-24593943 AGCCATTTCTGCTCAAACTCAGG + Intergenic
953370590 3:42384921-42384943 AACTCTTTCAGCTGATGCTTTGG - Intergenic
954241560 3:49297837-49297859 AGCAGTTTCTGCTGCAGGTCAGG - Intronic
955052090 3:55422933-55422955 AGCTCTCTCTTCTCAAGGTCAGG - Intergenic
955733262 3:62009811-62009833 ATATCATGCTGCTGAAGCTCAGG - Intronic
960982579 3:123244599-123244621 AGCACTTTCTGCTGAACTTGGGG + Intronic
961351354 3:126306697-126306719 AGCCCTGTGTGCTGAAGCTTTGG + Intergenic
964407334 3:156363001-156363023 TGCTCTTTCTGTGGCAGCTCTGG - Intronic
966615918 3:181912234-181912256 AGCTTTATCTTCTGAATCTCAGG - Intergenic
967576738 3:191103684-191103706 ACCTCTTTCTGCTGCACGTCTGG + Intergenic
969278173 4:6150994-6151016 AGCTCTTTCTCCCCAAGCTTTGG + Intronic
973079712 4:45974656-45974678 GGCTCTTAGTGCTGAATCTCTGG - Intergenic
974277004 4:59734633-59734655 TACTCTTTCTTTTGAAGCTCTGG - Intergenic
975550717 4:75609892-75609914 AGCTCTTTCTACTACAGCACAGG - Intronic
976235682 4:82894086-82894108 GGATTTTTCTGCTGAAGCTTTGG + Intronic
976305250 4:83553475-83553497 AGCACTGACTGCTGAAGGTCTGG + Intronic
977226252 4:94395690-94395712 TGCTCTTTGTTCTGCAGCTCTGG + Intergenic
978076082 4:104531550-104531572 AACTCTTCCTGCTGAAACTTTGG - Intergenic
980830829 4:138127881-138127903 ACCTGCTTCTGCTGAAGCTCAGG - Intergenic
983867911 4:172790141-172790163 AGCTTTTTCTGCAGACGCCCTGG - Intronic
986173207 5:5330557-5330579 AGCTCTTTCTGCTTGAGCAGGGG + Intergenic
986311181 5:6552146-6552168 AGCTCTTTCTGCTTCACTTCTGG - Intergenic
990528092 5:56648208-56648230 ATCTCTTTCTTCTGAGGATCTGG + Intergenic
992787383 5:80183170-80183192 AGCTCTACCTGCAGAATCTCTGG - Intronic
992845735 5:80745034-80745056 TGCTATTACTGCTGTAGCTCAGG - Intronic
994169914 5:96647763-96647785 TGCTCTTTCTGAAGGAGCTCGGG - Intronic
998218158 5:140253193-140253215 AGGTCTTTCTGCTGAAGGACAGG + Intronic
998968196 5:147563339-147563361 AGTTCTTTCTGCTGGAGGCCAGG + Intergenic
1001247016 5:170112358-170112380 AGCTCTTTCTGCTATGGCTGAGG + Intergenic
1001659019 5:173376608-173376630 AGCTCTTTCTTCAAAGGCTCTGG + Intergenic
1001963786 5:175896090-175896112 AGCTCTGTCTCCTGAAGACCAGG + Intergenic
1002307026 5:178289643-178289665 AGCTCTTTCTGCCAAAGCACGGG + Intronic
1003657365 6:8025053-8025075 AGTTCCTTCTGCTCAAGGTCAGG + Intronic
1004000526 6:11592985-11593007 AGCCCTTTCTCCTGGAGTTCAGG - Intergenic
1005001978 6:21250562-21250584 GCGTCTTTCTGCTGAAGCTTTGG + Intergenic
1005374400 6:25167345-25167367 TGCTCTTTCTCCTGAATCCCTGG + Intergenic
1005883419 6:30076336-30076358 AGCTCTTTCAGCTCTACCTCTGG + Intergenic
1006529959 6:34643353-34643375 ATCTTTTTCTGCTAAAGCTTTGG - Intronic
1006727640 6:36211299-36211321 AGCTCCTTCAGCTGCACCTCTGG - Exonic
1006794932 6:36725901-36725923 AGTGCTTTGTGCTGCAGCTCTGG + Exonic
1007542583 6:42661837-42661859 AGCTCTTTTACCTGGAGCTCAGG + Intronic
1012878233 6:104754768-104754790 AGTTCTTTCTTCAGGAGCTCTGG - Intronic
1015569928 6:134610461-134610483 ACCTCATTCTGCTGAATCCCAGG - Intergenic
1015690827 6:135920857-135920879 AGCACTTACTGATGAAGCTAGGG - Intronic
1015811548 6:137166226-137166248 AGCTCTTTGGGCTAAAGTTCCGG - Intronic
1015892595 6:137983447-137983469 TGCTCTCTCTGCTGTAGCCCGGG + Intergenic
1018200680 6:161392063-161392085 TGGTCTCTCTGGTGAAGCTCTGG + Intronic
1019192581 6:170261806-170261828 GGCTCTTTCTACAGAAGCTCAGG - Intergenic
1020774622 7:12437281-12437303 AGCTCTGACTGCTGGAGCTCTGG - Intergenic
1022129736 7:27394206-27394228 AGCTTCCTCTGCAGAAGCTCAGG + Intergenic
1022289135 7:28984412-28984434 AGCTCTTTCTGGAGAAGCTGTGG - Intergenic
1023753394 7:43393165-43393187 CCCTCTCTCTGTTGAAGCTCTGG - Intronic
1024480429 7:49856410-49856432 ATCTTTTTCTGGTGAACCTCAGG - Intronic
1024653231 7:51426521-51426543 GGCTGTTTCTTCTGTAGCTCAGG - Intergenic
1024660556 7:51489143-51489165 AGCTCTTCCTCCTGCAGCCCAGG - Intergenic
1026097877 7:67361119-67361141 AGCTCTTTCTGCTGCAGAGAGGG - Intergenic
1028154101 7:87409805-87409827 AGCTTTTTCTGATAAAGCTCTGG + Intronic
1029166581 7:98595757-98595779 AGCACATTCTGCAGAAGCTCCGG + Intergenic
1029354260 7:100039419-100039441 AAGTCTGTCTGATGAAGCTCGGG + Exonic
1033061789 7:138116437-138116459 AGCACCTTTTCCTGAAGCTCTGG - Intronic
1033088203 7:138361672-138361694 AGCTCTTTCTGCCCAACCTTTGG + Intergenic
1033516089 7:142108034-142108056 AGCTCTTTCTGCGTTAACTCCGG - Intergenic
1033686473 7:143645377-143645399 AGCTCATTCTGCACAAACTCTGG - Intronic
1033689264 7:143721938-143721960 AGCTCATTCTGCACAAACTCTGG + Intronic
1033698139 7:143812244-143812266 AGCTCATTCTGCACAAACTCTGG + Intergenic
1033992834 7:147308839-147308861 TGCTCTTTCTGCTGCATCTAGGG + Intronic
1034463930 7:151214486-151214508 TGCTCATTCCTCTGAAGCTCTGG - Intronic
1035488946 7:159255184-159255206 GGCTCTTCCTCCTGAAGCTTAGG - Intergenic
1036260619 8:7236681-7236703 AGCTCTTACGGCTGCAGGTCTGG - Intergenic
1036305994 8:7602841-7602863 AGCTCTTACGGCTGCAGGTCTGG + Intergenic
1036312656 8:7695237-7695259 AGCTCTTACGGCTGCAGGTCTGG - Intergenic
1036356840 8:8050826-8050848 AGCTCTTACGGCTGCAGATCTGG + Intergenic
1036450277 8:8860171-8860193 TGCTCTTTCTGTGGAATCTCAGG - Intronic
1036773538 8:11594487-11594509 AGAGCCTTCTGCTAAAGCTCTGG - Intergenic
1037446580 8:18971564-18971586 AACTCCTTGTGCTGAAGCCCGGG - Intronic
1038045196 8:23760412-23760434 TGCTCTCTTTGCAGAAGCTCAGG - Intergenic
1038575396 8:28700466-28700488 CGCCCTTTCTGCTGGAGCCCAGG - Intronic
1041176510 8:55202598-55202620 AGCACTTACAGCTGAAGGTCTGG + Intronic
1044300697 8:90579866-90579888 ACCTCTTAGTGCTGAGGCTCAGG - Intergenic
1049053744 8:140219075-140219097 GGCTCTTCCTGCTGAATTTCTGG - Intronic
1050463607 9:5897706-5897728 AGTTCTTTCCTCTGAATCTCTGG + Intronic
1052013330 9:23436785-23436807 AGTTCTTTCTCATGAAGCTGAGG + Intergenic
1052865634 9:33463247-33463269 AGCTCTATCTGACGCAGCTCAGG - Exonic
1055751007 9:79504801-79504823 AGCTCCTTCTGTTGGAGCTGTGG - Intergenic
1056275135 9:84986997-84987019 GGCTGTTTCTGATGAAGCTGAGG + Intronic
1056310680 9:85338011-85338033 TGCTATTTCTGATGAGGCTCTGG + Intergenic
1056809741 9:89754937-89754959 AGCTGTCTCTTCTAAAGCTCAGG + Intergenic
1060146954 9:121261248-121261270 AGCTCTTCCTGCTAAATCCCTGG + Intronic
1060860312 9:126948642-126948664 GGCTCTGTATGCTGAAGCTGAGG - Intronic
1061185106 9:129048446-129048468 TGCTCTTGCTGCTGGGGCTCTGG - Exonic
1061499188 9:130992475-130992497 AGCTCTTTCTGCTGAGGACAAGG - Intergenic
1062007892 9:134250615-134250637 AGCACCTTCTGCTGAGGATCTGG + Intergenic
1062112984 9:134792199-134792221 AGCTCTTTATCCTGAGGCACTGG + Intronic
1062359741 9:136182088-136182110 AGCTCATTCTGTTGGACCTCAGG + Intergenic
1185487992 X:497782-497804 ACCTCTTTCTGGGGAAGCTCCGG + Intergenic
1191045163 X:56128443-56128465 AGATTTTTCTGCCAAAGCTCTGG - Intergenic
1192222423 X:69206454-69206476 GGCTCTCTCTGCTGAGGCTGAGG - Intergenic
1194039048 X:88917046-88917068 AGCCCTTTCTCCTGAAGTACGGG + Intergenic
1195247346 X:103006311-103006333 AGATCTCTCTGCTGTAGCTTTGG - Intergenic
1199019343 X:142858014-142858036 TGCTCTTTCTTCTAAAGCACCGG + Intergenic
1199238008 X:145512298-145512320 AGCTGCTTGTGATGAAGCTCAGG + Intergenic