ID: 915054964

View in Genome Browser
Species Human (GRCh38)
Location 1:153119856-153119878
Sequence TCCCTGTGTTGAAAGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915054962_915054964 8 Left 915054962 1:153119825-153119847 CCATAAAAGAAAGGAAAATTTGT No data
Right 915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915054964 Original CRISPR TCCCTGTGTTGAAAGAGTGC TGG Intergenic
No off target data available for this crispr