ID: 915056978

View in Genome Browser
Species Human (GRCh38)
Location 1:153142098-153142120
Sequence GGTCAAACCCAGGATTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915056978_915056981 26 Left 915056978 1:153142098-153142120 CCTATATAATCCTGGGTTTGACC No data
Right 915056981 1:153142147-153142169 CTTTTCCACCCAATCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915056978 Original CRISPR GGTCAAACCCAGGATTATAT AGG (reversed) Intergenic
No off target data available for this crispr