ID: 915057396

View in Genome Browser
Species Human (GRCh38)
Location 1:153147191-153147213
Sequence CTGCAATTCTGGAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915057396 Original CRISPR CTGCAATTCTGGAGGAAAAC AGG Intergenic
902070677 1:13733381-13733403 CAGCAATTCTGGAAGACAGCAGG + Intronic
902569335 1:17336873-17336895 CTGCATTTCGGGAGGGATACAGG - Intronic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
908658581 1:66414149-66414171 CTGCAATTCTGAAGAGGAACAGG - Intergenic
908729581 1:67212323-67212345 CTGCATGTCTGTAGGAAGACAGG + Intronic
910571157 1:88705256-88705278 CTAAAATTCTAGAAGAAAACAGG - Intronic
912972149 1:114293680-114293702 GTGCACTTCTGGAGGAAGGCTGG - Intergenic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917588739 1:176455474-176455496 CCACAATTCAAGAGGAAAACAGG + Intergenic
918771445 1:188565893-188565915 CTGCAATTCTTGAGTATACCTGG + Intergenic
918836969 1:189478666-189478688 GTGGAATTCTGGTGGAAGACTGG + Intergenic
922932116 1:229398042-229398064 CTGCACTTCTGAAAGAAAACAGG + Intergenic
923299065 1:232623733-232623755 AAGCAATTCTGGAAGAAAACAGG + Intergenic
924287382 1:242502119-242502141 CTGAAATTCAGGAGGACAGCTGG - Intronic
1063949684 10:11210442-11210464 CTGCAATTCTGCGGCAAAGCTGG - Intronic
1068785508 10:60968160-60968182 CTGCACCTCTACAGGAAAACTGG + Intronic
1070256705 10:74819167-74819189 CTGCAATTATGGTGAAAAATTGG + Intergenic
1072275135 10:93815540-93815562 CTCCAATTCTGGAGTCAAAAGGG - Intergenic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1073899119 10:108198717-108198739 CTGCTTTTCTGGAAGAAATCTGG - Intergenic
1074296142 10:112191425-112191447 CACCAATTCTAGAGGGAAACTGG + Intronic
1074407153 10:113189315-113189337 CTGAAATTCTAGGGGAGAACAGG - Intergenic
1074824920 10:117207781-117207803 CTGCACTTCTGGAGGAAGTTGGG + Intronic
1075246739 10:120829243-120829265 CTGCAATGCTGGTCAAAAACAGG + Intergenic
1075821480 10:125316603-125316625 CAGGAATTCTGGAGGTAGACTGG + Intergenic
1078635212 11:13043209-13043231 CTGGAATTCAGGAGGAGAAATGG + Intergenic
1078890579 11:15553278-15553300 ATGCAAATCAGGAGGAAAAAAGG - Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080644406 11:34177884-34177906 CTGCAGTTCAGGAGTAAAGCTGG - Intronic
1080656380 11:34261920-34261942 CAGCATTTCTGGAGGACAGCAGG + Intronic
1081207777 11:40294362-40294384 CTGGATTTCTGGATGAAAACAGG - Intronic
1085671543 11:78469306-78469328 AAGAAATGCTGGAGGAAAACAGG + Exonic
1088727107 11:112648981-112649003 TTGCATTTCTGTAGGAAAAAGGG + Intergenic
1089080247 11:115770121-115770143 CAGCAATTCTGAGGGAAACCTGG - Intergenic
1089118129 11:116112674-116112696 CGGCATTTCTGCAGGACAACAGG - Intergenic
1091157869 11:133390501-133390523 CTGCAAGTCTGAAGAAAAATAGG + Intronic
1091956965 12:4653304-4653326 TTGTCATTCTGGAGGAACACAGG + Intronic
1092671428 12:10866376-10866398 GTGTAATTCTGAAGGAAAAGAGG + Intronic
1093497893 12:19779027-19779049 CTGCAATTGTGAAGAAATACAGG - Intergenic
1095660197 12:44723707-44723729 CTGTAAATGTGGATGAAAACAGG - Intronic
1095669049 12:44836533-44836555 CTGAAATTCTGAAGGAATAAAGG + Intronic
1095775373 12:46004186-46004208 CAGCCATTCTGGAGGAGAAGAGG - Intergenic
1095959994 12:47828518-47828540 CTCAAATTATAGAGGAAAACAGG - Intronic
1096449216 12:51723069-51723091 ATGCATGTATGGAGGAAAACTGG + Intronic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1099018628 12:77375784-77375806 ATGAAAGTCTGGAGGAAAATGGG - Intergenic
1101084984 12:101226628-101226650 CTGTAAGGCTGGAGGAAACCAGG - Intergenic
1102271603 12:111541242-111541264 CTTTAATTCTGGAGGAAAGGTGG - Intronic
1102701245 12:114841336-114841358 CTGCCATTGTGAAGAAAAACTGG - Intergenic
1104357033 12:128095959-128095981 CTTTAGTTCTGGAAGAAAACAGG - Intergenic
1104549468 12:129743258-129743280 CTGCAATTCAAGATGAAAAGTGG - Intronic
1105270142 13:18865542-18865564 GGTCAATTCTGGAGGAAACCAGG - Intergenic
1107041036 13:35947639-35947661 TTTCAGTTCTGCAGGAAAACAGG + Intronic
1108127795 13:47263320-47263342 CTGCAAATCTGCAGCAAAAACGG - Intergenic
1108887672 13:55208169-55208191 CTGCAATTATAGAAGAAGACTGG + Intergenic
1109813202 13:67543337-67543359 CTGCATTTCAGGAGGATAGCAGG - Intergenic
1111084511 13:83357247-83357269 CTGCAAGTCTGAAGGAACAAGGG - Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1112065099 13:95784378-95784400 GTGAAAATCTGGAGGAAACCAGG + Intronic
1112409792 13:99153074-99153096 CTGCCATTCTGGGTGAAATCAGG + Intergenic
1114385470 14:22249926-22249948 CAGCCATTTTGGAAGAAAACTGG - Intergenic
1114712423 14:24792282-24792304 CTGCAACTCTGTGGGAAAAGGGG - Intergenic
1115297265 14:31842732-31842754 CTGAAAGTCTGGAGGTAGACTGG - Intronic
1116288953 14:43007295-43007317 CTACAAATCTGCAGGCAAACAGG + Intergenic
1118636372 14:67752051-67752073 CTGCAATTCTAGAGGAGGTCAGG - Intronic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1122374317 14:101248248-101248270 CTGGAATCCTGGAGGAACCCTGG + Intergenic
1122746670 14:103901168-103901190 CTGCGCTGCTGGAGGAAAAGTGG - Intergenic
1123119518 14:105910246-105910268 CTGCATTTCTGGAAGAACAAGGG - Intergenic
1125168836 15:36742686-36742708 CTGCAGTTTTGAAAGAAAACTGG - Intronic
1128062699 15:64745282-64745304 CTGCATTTATGGAAAAAAACAGG - Intronic
1131402347 15:92135189-92135211 CTGCAACTCTGAAGGAACACAGG - Intronic
1133263708 16:4570036-4570058 CTTCACTTCTGGAGAAAAAGTGG - Intronic
1134058841 16:11186897-11186919 ATGCAATTCTGGAGGCCAAGGGG - Intergenic
1135137402 16:19895236-19895258 CTGCCATGCAGGAGGAAACCGGG + Intergenic
1135227274 16:20671774-20671796 TTGCAACACTAGAGGAAAACTGG + Intronic
1137792166 16:51184492-51184514 CTGCAATTCTAAAAGAAACCTGG - Intergenic
1137898063 16:52235540-52235562 TTGCAATTTTGGAGAAAACCTGG - Intergenic
1138371190 16:56527689-56527711 CTGCCATTCTGGGGGAAAGGTGG - Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1142255950 16:89014048-89014070 CTGCATTTGGGGAGGAAAAGGGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144759503 17:17699431-17699453 CTGCAATTTTGGGGCAAAATAGG - Intronic
1148358850 17:46995508-46995530 GTGCAATTCTGGGGAAAAAAAGG + Intronic
1148656988 17:49292233-49292255 CTCCAGTTTTGGAGGAGAACTGG + Intronic
1149442385 17:56685626-56685648 CTGAAATTCTGCATGAAAGCAGG + Intergenic
1149750605 17:59141889-59141911 CAGCAATTCTGGAGGATGCCTGG + Intronic
1151974476 17:77476533-77476555 CTGCAACTCTGGAGAAAAGATGG + Intronic
1154417898 18:14194430-14194452 GGTCAATTCTGGAGGAAACCAGG + Intergenic
1155268310 18:24115263-24115285 CAACAATTCTGGAGGAGAATGGG - Intronic
1155372306 18:25114274-25114296 CTGCAATACTGGTGGAAAAGAGG + Intronic
1157434171 18:47654522-47654544 CTGCAACTCTAGAGGTAAATGGG + Intergenic
1159243772 18:65778334-65778356 CTACAATTCTGTAGGAATTCAGG - Intronic
1164871902 19:31652856-31652878 CAGCAATTCTGGAGAAAATTGGG + Intergenic
1167197458 19:48040469-48040491 CTAGAAGTCTGGAAGAAAACAGG - Intronic
1167901589 19:52626310-52626332 CAGCAATTTTGGAGGACAACTGG - Intronic
1168363060 19:55759290-55759312 CTGTATTTCTGGAGGATAAGGGG + Intronic
926489394 2:13505353-13505375 CTTCAGTTCTGGTGGAAACCTGG - Intergenic
927007225 2:18863422-18863444 CTGTAATCCTGGAGGAACAATGG + Intergenic
927343000 2:22003785-22003807 CTGGAATTCTATAGGAAAACAGG - Intergenic
928452313 2:31387811-31387833 CAGCAACTCTGGGGGAAAAATGG + Exonic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
929315610 2:40474516-40474538 CAGGAACTCTGGAAGAAAACGGG - Intronic
929345467 2:40878506-40878528 GTGCAATTCAGGAGGAACAGAGG - Intergenic
929747191 2:44671229-44671251 GTGCAATTTTGAAGGAAAAAAGG - Intronic
932077873 2:68681990-68682012 CTGGAAATCTTGAGAAAAACGGG + Intronic
932309745 2:70730160-70730182 CTGCAATTTGGGAGCAAAATAGG - Intronic
932749425 2:74361976-74361998 CTCCAATTCTGGAGGAGAGGGGG + Intronic
932997272 2:76870441-76870463 CTGAAATACTGGGGGAAAAAAGG + Intronic
937425346 2:121794526-121794548 CTACATTTCTTGAGGAAGACTGG - Intergenic
940069224 2:149666113-149666135 CTAAAATTCTTGAGGAAAATAGG - Intergenic
940430009 2:153578685-153578707 CTGCAATTCTACAGGCAAAATGG - Intergenic
941140324 2:161772723-161772745 TTACAATTTTGAAGGAAAACAGG + Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941454377 2:165697691-165697713 CTGAAATACTGAAGGAAAAGTGG + Intergenic
942171108 2:173290475-173290497 CTGCGATTCCTCAGGAAAACAGG - Intergenic
942433708 2:175946553-175946575 CTGCATTTTTGAAGGAAAACAGG + Intronic
942663992 2:178296929-178296951 CTGCTATTCTGGAGGATGACAGG + Intronic
943039494 2:182787324-182787346 CTGGAATTATGGAAGAAAATAGG + Exonic
944543368 2:200775650-200775672 CAGCATTTCTGGAGTAAAATAGG - Intergenic
945340476 2:208646776-208646798 CTGCAAGATTGGAGGAAGACAGG + Intronic
945729956 2:213521348-213521370 CTGCAAGTCAGAATGAAAACAGG - Intronic
1169583698 20:7056905-7056927 CTGCAAGTGTGGAAGAAAAATGG - Intergenic
1170530495 20:17286725-17286747 CTGCAATTCATGAGCAAAGCAGG - Intronic
1172659161 20:36555622-36555644 CTGGAATTCAGGAGGAACCCTGG + Intergenic
1174110036 20:48192670-48192692 CAGAAATTCTGCAGGAAAACCGG + Intergenic
1175017150 20:55803946-55803968 CTGGAGTTCTGGAGGTATACAGG - Intergenic
1175558944 20:59900911-59900933 TGGCAATTTTGGAAGAAAACAGG - Intronic
1176855400 21:13964840-13964862 GGTCAATTCTGGAGGAAACCAGG - Intergenic
1177088672 21:16739342-16739364 CTGCACTTCTGGAGTAAAGTCGG + Intergenic
1177565981 21:22820479-22820501 TTGGAATTTAGGAGGAAAACTGG + Intergenic
1181282184 22:21727967-21727989 CTGCAAAGCTGGAGGAGAACTGG + Intronic
950115903 3:10450264-10450286 CAGCAATTCTTGAGGGAAAGGGG - Intronic
951646332 3:24895785-24895807 GTGCATTTGTGGTGGAAAACAGG + Intergenic
954075962 3:48180643-48180665 CTTCAATTCTGGATGAAAGAAGG + Intronic
955055983 3:55456592-55456614 CTGCAATTCTAGGGGGAACCAGG - Intergenic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955898324 3:63724870-63724892 CTGCCATTCTTGATGCAAACAGG + Intergenic
956275832 3:67500098-67500120 CAGCAATGCTGGAGGAGAATAGG - Intronic
963118336 3:141753189-141753211 AAGCAATTTTGGAGGAAAATAGG - Intergenic
963247310 3:143075065-143075087 CTGGGTCTCTGGAGGAAAACCGG + Intergenic
964772312 3:160237419-160237441 CAGCAGCTCTGGAGTAAAACAGG - Intronic
966693327 3:182763266-182763288 TGGCATTTCTGGAAGAAAACAGG - Intergenic
966878804 3:184338312-184338334 CGGCAATACTGGATGAAAATGGG + Intronic
967277585 3:187791565-187791587 CTGCAGTTGTGGAGGAACAGTGG + Intergenic
970346914 4:15161228-15161250 CTTGAAATCTGGAAGAAAACTGG + Intergenic
971127541 4:23770980-23771002 CTGCCCCTATGGAGGAAAACGGG + Intronic
971147074 4:23989458-23989480 CAGCAATCCTGCAGGAAAATTGG + Intergenic
972013150 4:34209439-34209461 CTGCACCCCTGGAGTAAAACAGG + Intergenic
974169889 4:58252472-58252494 GTCCAATTCTTGAAGAAAACTGG - Intergenic
976242480 4:82972986-82973008 CCGCAATTCCTGAGGATAACTGG + Intronic
976373374 4:84315930-84315952 AAGCAATTCTGGAGAAAAAATGG + Intergenic
982841521 4:160193902-160193924 CAGCAAAACTGGAGGCAAACTGG - Intergenic
987602675 5:20092025-20092047 CTGCAATCATGTAAGAAAACAGG - Intronic
987644400 5:20649387-20649409 CTGCAATTGTGGAGAAATATAGG + Intergenic
988336980 5:29920297-29920319 CTACAAGTCTGTGGGAAAACTGG - Intergenic
990316721 5:54589760-54589782 CTGCAAAACTAGAGGAAACCAGG + Intergenic
993054206 5:82962849-82962871 CTTTAAGACTGGAGGAAAACGGG - Intergenic
995002392 5:107149926-107149948 CTTCATGTCTGGAGAAAAACTGG + Intergenic
997669768 5:135661184-135661206 CTGCTGTTCTGGAGGCAGACAGG - Intergenic
997986841 5:138508472-138508494 CTGCAATTCTGCAAGAGAATAGG - Intronic
998234979 5:140390815-140390837 TTCCAACTCTGGAGGAAAAGTGG - Intergenic
998486433 5:142506507-142506529 ATGCAATGCTGGAGGAGAGCAGG + Intergenic
1000024218 5:157344881-157344903 CTCCACTCCTGGAGGAAAATGGG - Intronic
1001257084 5:170192451-170192473 AGACAATTCTGGAAGAAAACAGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1007228937 6:40334764-40334786 CTACACATCTGCAGGAAAACAGG - Intergenic
1007851893 6:44811115-44811137 ATGCAATTCTGGAGCAGAAACGG - Intronic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1010734196 6:79424681-79424703 CTGGAAGTCTGGAACAAAACAGG + Intergenic
1010994606 6:82518981-82519003 CTGCAAATCTGCAGGAAAGCAGG + Intergenic
1012659989 6:101875965-101875987 ATGTAATTCTAGAAGAAAACAGG - Intronic
1016322100 6:142857639-142857661 CTGAAGTTTTGGAGAAAAACAGG - Intronic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1017619162 6:156277598-156277620 TAACAATTCTGGAGGAAAACAGG - Intergenic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1020773179 7:12421275-12421297 CTTCGATTTTGGAAGAAAACTGG + Intergenic
1020838208 7:13181586-13181608 CTGCGATCCTGGAGTATAACTGG - Intergenic
1021922869 7:25504381-25504403 CTACAATTCTAGAGTATAACAGG - Intergenic
1023686287 7:42738787-42738809 CTTCATTTTTGGAGGCAAACTGG - Intergenic
1024802192 7:53092938-53092960 CTACAATTCTGGTTGAACACAGG + Intergenic
1025730183 7:64101486-64101508 ATCCAAGTCAGGAGGAAAACAGG - Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028946535 7:96586257-96586279 CTGGAATTCTGTAGGAAAGAAGG - Intronic
1032503550 7:132418356-132418378 CTGATATTATGGTGGAAAACAGG - Intronic
1032909015 7:136407722-136407744 CTGCAATACTGGGGACAAACTGG - Intergenic
1033572608 7:142647101-142647123 TTTCAATTCTGGCAGAAAACTGG - Intergenic
1034027465 7:147721701-147721723 ATTGAATCCTGGAGGAAAACAGG + Intronic
1034507357 7:151504053-151504075 CTGCCAGTCTGGAGGGAGACAGG - Intronic
1038125230 8:24666057-24666079 CTGCATTTATGTAAGAAAACAGG + Intergenic
1039504223 8:38040255-38040277 CAGCAATGCTGGATGCAAACAGG - Intronic
1040714986 8:50240211-50240233 CTGCATTTCAGGAGCAAAAATGG - Intronic
1040831455 8:51681535-51681557 CTGCAGATCTGGGGGTAAACAGG + Intronic
1041826583 8:62101786-62101808 CTGCAAATTTGTAGGCAAACAGG - Intergenic
1042598997 8:70479493-70479515 TTCCAAAGCTGGAGGAAAACTGG + Intergenic
1045368187 8:101494690-101494712 CTCGAATTCTGAATGAAAACGGG + Intronic
1046007888 8:108508019-108508041 ATGCAATTCTTAAGGAAAAGAGG + Intergenic
1046263407 8:111800622-111800644 CTGTAATTCTGAAAGAAATCAGG + Intergenic
1047432620 8:124805830-124805852 CTGGAATTCAGAAGGAAGACAGG - Intergenic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048170954 8:132105727-132105749 CTGCATTATTGCAGGAAAACTGG + Intronic
1048961492 8:139583331-139583353 CAGCAACTCTGGAGTAAAAAGGG - Intergenic
1048966917 8:139621839-139621861 CTGGAATGCTGGAGAATAACAGG + Intronic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1051551519 9:18335165-18335187 CTCCATTTCTGGTAGAAAACAGG + Intergenic
1052679131 9:31666311-31666333 AAGTAATTCTGGAGGAATACAGG + Intergenic
1053420546 9:37974830-37974852 CTGAAATTCTGCAGGCAAAAAGG + Exonic
1053579205 9:39386412-39386434 AAGCAATTCTGGAAGAAAAATGG - Intergenic
1054100789 9:60945218-60945240 AAGCAATTCTGGAAGAAAAATGG - Intergenic
1054122163 9:61220592-61220614 AAGCAATTCTGGAAGAAAAATGG - Intergenic
1054585559 9:66961667-66961689 AAGCAATTCTGGAAGAAAAATGG + Intergenic
1055214812 9:73846225-73846247 CTAAAACTCTGGGGGAAAACAGG + Intergenic
1055394105 9:75855124-75855146 CTGCAATTCTGGAGAAAAGAGGG + Intergenic
1056170020 9:83975976-83975998 CTGAAATTCTTGAGGAAATGGGG + Intronic
1059806123 9:117802516-117802538 ATGGGATTCTGGAGGAAAAATGG + Intergenic
1060673009 9:125486825-125486847 CTGCTCTTCAGTAGGAAAACAGG - Intronic
1061441676 9:130608545-130608567 CTCCCATTCTGCATGAAAACTGG - Intronic
1061696860 9:132382574-132382596 GTGAAATTTTGGAGGAATACAGG - Intronic
1062010444 9:134264110-134264132 CTCCACTTCTGGATGAAAAGAGG + Intergenic
1062034141 9:134375358-134375380 CTGCAATTCTGGAGGCAGGAAGG - Intronic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1186154431 X:6710855-6710877 CTCCAGCTATGGAGGAAAACTGG - Intergenic
1188280001 X:28255462-28255484 CTGCAATCCTGGTGGAAATCTGG - Intergenic
1189200363 X:39190330-39190352 GTGCAATTCTGGAGTCAAAGGGG - Intergenic
1192756394 X:74050301-74050323 CTGCAACTGTGAAGGAATACAGG + Intergenic
1195370868 X:104170896-104170918 CTGCTATTCTGGAGTCCAACAGG - Intronic
1197332167 X:125167064-125167086 CATAAAATCTGGAGGAAAACTGG + Intergenic
1199640853 X:149859320-149859342 CTGCCATGCTGGAGGAGAAGAGG - Intergenic
1199763560 X:150924385-150924407 TTTCATATCTGGAGGAAAACAGG + Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic