ID: 915059016

View in Genome Browser
Species Human (GRCh38)
Location 1:153164398-153164420
Sequence ATCTCTAATCCAATGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915059013_915059016 2 Left 915059013 1:153164373-153164395 CCTGGAGAAAGTCATTTAGTCCA No data
Right 915059016 1:153164398-153164420 ATCTCTAATCCAATGCTGATGGG No data
915059012_915059016 14 Left 915059012 1:153164361-153164383 CCAGCAACTATTCCTGGAGAAAG No data
Right 915059016 1:153164398-153164420 ATCTCTAATCCAATGCTGATGGG No data
915059011_915059016 17 Left 915059011 1:153164358-153164380 CCACCAGCAACTATTCCTGGAGA No data
Right 915059016 1:153164398-153164420 ATCTCTAATCCAATGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915059016 Original CRISPR ATCTCTAATCCAATGCTGAT GGG Intergenic
No off target data available for this crispr