ID: 915060403

View in Genome Browser
Species Human (GRCh38)
Location 1:153177445-153177467
Sequence GTGCTAGTATGAATGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915060403_915060407 -4 Left 915060403 1:153177445-153177467 CCACCTTACATTCATACTAGCAC No data
Right 915060407 1:153177464-153177486 GCACTGTATGAGAGTTCCAGGGG No data
915060403_915060406 -5 Left 915060403 1:153177445-153177467 CCACCTTACATTCATACTAGCAC No data
Right 915060406 1:153177463-153177485 AGCACTGTATGAGAGTTCCAGGG No data
915060403_915060405 -6 Left 915060403 1:153177445-153177467 CCACCTTACATTCATACTAGCAC No data
Right 915060405 1:153177462-153177484 TAGCACTGTATGAGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915060403 Original CRISPR GTGCTAGTATGAATGTAAGG TGG (reversed) Intergenic
No off target data available for this crispr