ID: 915060986

View in Genome Browser
Species Human (GRCh38)
Location 1:153184799-153184821
Sequence CTGAATGTGCAAAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915060986_915060990 -5 Left 915060986 1:153184799-153184821 CCTTCCAGTTTTTGCACATTCAG No data
Right 915060990 1:153184817-153184839 TTCAGTATGATACTGGCTATGGG 0: 30
1: 880
2: 10920
3: 5659
4: 4447
915060986_915060989 -6 Left 915060986 1:153184799-153184821 CCTTCCAGTTTTTGCACATTCAG No data
Right 915060989 1:153184816-153184838 ATTCAGTATGATACTGGCTATGG 0: 30
1: 932
2: 10987
3: 5633
4: 4352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915060986 Original CRISPR CTGAATGTGCAAAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr