ID: 915061479

View in Genome Browser
Species Human (GRCh38)
Location 1:153189562-153189584
Sequence GTTACTTACATATAAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061479_915061482 11 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061482 1:153189596-153189618 GTTTATGTGGCTACTCAAGTTGG No data
915061479_915061484 20 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061484 1:153189605-153189627 GCTACTCAAGTTGGGTTTCCTGG No data
915061479_915061483 12 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061483 1:153189597-153189619 TTTATGTGGCTACTCAAGTTGGG No data
915061479_915061481 -2 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061481 1:153189583-153189605 ACTAAGGAAACTTGTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061479 Original CRISPR GTTACTTACATATAAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr