ID: 915061481

View in Genome Browser
Species Human (GRCh38)
Location 1:153189583-153189605
Sequence ACTAAGGAAACTTGTTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061479_915061481 -2 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061481 1:153189583-153189605 ACTAAGGAAACTTGTTTATGTGG No data
915061478_915061481 27 Left 915061478 1:153189533-153189555 CCATAGAAAATATTATCTGTTGA No data
Right 915061481 1:153189583-153189605 ACTAAGGAAACTTGTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061481 Original CRISPR ACTAAGGAAACTTGTTTATG TGG Intergenic