ID: 915061483 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:153189597-153189619 |
| Sequence | TTTATGTGGCTACTCAAGTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915061479_915061483 | 12 | Left | 915061479 | 1:153189562-153189584 | CCATCTTTTTATATGTAAGTAAC | No data | ||
| Right | 915061483 | 1:153189597-153189619 | TTTATGTGGCTACTCAAGTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915061483 | Original CRISPR | TTTATGTGGCTACTCAAGTT GGG | Intergenic | ||