ID: 915061483

View in Genome Browser
Species Human (GRCh38)
Location 1:153189597-153189619
Sequence TTTATGTGGCTACTCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915061479_915061483 12 Left 915061479 1:153189562-153189584 CCATCTTTTTATATGTAAGTAAC No data
Right 915061483 1:153189597-153189619 TTTATGTGGCTACTCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915061483 Original CRISPR TTTATGTGGCTACTCAAGTT GGG Intergenic